Display Settings:

Format

Send to:

Choose Destination
1.

rs281864899 [Homo sapiens]
    GGCAAGGTGAACGTGGATGAAGTTG[CAC/G]TGGTGAGGCCCTGGGCAGGTTGGTA
    Chromosome:
    11:5226948
    Gene:
    HBB (GeneView)
    Functional Consequence:
    frameshift variant
    Allele Origin:
    C(germline)/+.-----(germline)
    Validated:
    no info
    HGVS:
    NC_000011.10:g.5226948delCinsGTG, NC_000011.9:g.5248178delCinsGTG, NG_000007.3:g.70668delGinsCAC, NM_000518.4:c.74delGinsCAC, NP_000509.1:p.Gly25Alafs

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center