Display Settings:

Format

Send to:

Choose Destination
1.

rs281864892 [Homo sapiens]
    CTGGTTGTCTACCCATGGACCCAGA[A/G]GTTCTTTGACAGCTTTGGCAACCTG
    Chromosome:
    11:5254485
    Gene:
    HBG2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000011.10:g.5254485C>T, NC_000011.9:g.5275715C>T, NG_000007.3:g.43131G>A, NM_000184.2:c.122G>A, NP_000175.1:p.Arg41Lys

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center