Display Settings:

Format

Send to:

Choose Destination
1.

rs281864826 [Homo sapiens]
    CCCCGCAGGATGTTCCTGTCCTTCC[C/G/T]CACCACCAAGACCTACTTCCCGCAC
    Chromosome:
    16:173142
    Gene:
    HBA2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/T(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    by cluster
    HGVS:
    NC_000016.10:g.173142C>G, NC_000016.10:g.173142C>T, NC_000016.9:g.223141C>G, NC_000016.9:g.223141C>T, NG_000006.1:g.34005C>G, NG_000006.1:g.34005C>T, NM_000517.4:c.113C>G, NM_000517.4:c.113C>T, NP_000508.1:p.Pro38Arg, NP_000508.1:p.Pro38Leu

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center