Display Settings:

Format

Send to:

Choose Destination
1.

rs281864442 has merged into rs117578558 [Homo sapiens]
    CAGGGTGTATTGTCATCACCTCCCC[C/T]AAGATCTGTGCAAAGGTGAAATCAG
    Chromosome:
    6:32660383
    Gene:
    HLA-DQB1-AS1 (GeneView) HLA-DQB1 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0697/349
    HGVS:
    NC_000006.11:g.32628160C>T, NC_000006.12:g.32660383C>T, NG_029922.1:g.11681G>A, NM_001243961.1:c.797-134G>A, NM_001243962.1:c.773-134G>A, NM_002123.4:c.773-134G>A, NR_133907.1:n.206C>T, NT_167245.1:g.3906797C>T, NT_167245.2:g.3901212C>T, NT_167246.1:g.4083454C>T, NT_167246.2:g.4077834C>T, NT_167247.1:g.3962335C>T, NT_167247.2:g.3956750C>T, NT_167248.1:g.3859885C>T, NT_167248.2:g.3854289C>T, NT_167249.1:g.4056913C>T, NT_167249.2:g.4057615C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center