Display Settings:

Format

Send to:

Choose Destination
1.

rs281860618 [Homo sapiens]
    CTGCTGGTGACCCTGGCCGCCCACC[A/G/T]CCCCGCCGAGTTCACCCCTGCGGTG
    Chromosome:
    16:173512
    Gene:
    HBA2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/T(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by cluster
    HGVS:
    NC_000016.10:g.173512T>A, NC_000016.10:g.173512T>G, NC_000016.9:g.223511T>A, NC_000016.9:g.223511T>G, NG_000006.1:g.34375T>A, NG_000006.1:g.34375T>G, NM_000517.4:c.341T>A, NM_000517.4:c.341T>G, NP_000508.1:p.Leu114Arg, NP_000508.1:p.Leu114His

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center