Display Settings:

Format

Send to:

Choose Destination
1.

rs267606569 [Homo sapiens]
    ATCACGCCGCTGCTGCTCAACTACT[A/G]CCAGTGCAAGCTGGTGGTCGAGGAG
    Chromosome:
    11:67490383
    Gene:
    AIP (GeneView) MIR6752 (GeneView)
    Functional Consequence:
    downstream variant 500B,missense
    Allele Origin:
    G(germline)/A(germline,unknown)
    Clinical significance:
    Likely pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000011.10:g.67490383G>A, NC_000011.9:g.67257854G>A, NG_008969.1:g.12350G>A, NM_001302959.1:c.536G>A, NM_001302960.1:c.713G>A, NM_003977.2:c.713G>A, NM_003977.3:c.713G>A, NP_001289888.1:p.Cys179Tyr, NP_001289889.1:p.Cys238Tyr, NP_003968.2:p.Cys238Tyr, NP_003968.3:p.Cys238Tyr, NR_106810.1:n.139G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center