Display Settings:

Format

Send to:

Choose Destination
1.

rs267606562 [Homo sapiens]
    GTTGCCGAAAGGGAGCAGCGGGGAA[C/G]GAGGATGGCGGATATCATCGCAAGA
    Chromosome:
    11:67483154
    Gene:
    AIP (GeneView)
    Functional Consequence:
    upstream variant 2KB,utr variant 5 prime
    Allele Origin:
    G(germline)/C(germline,unknown)
    Clinical significance:
    Likely benign
    Validated:
    no info
    HGVS:
    NC_000011.10:g.67483154G>C, NC_000011.9:g.67250625G>C, NG_008969.1:g.5121G>C, NM_001302959.1:c.-635G>C, NM_001302960.1:c.-5G>C, NM_003977.2:c.-5G>C, NM_003977.3:c.-5G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center