Display Settings:

Format

Send to:

Choose Destination
1.

rs267243325 has merged into rs109411452 [Bos taurus]
    AGCGCTAACATCCTTTTTTTTCTCT[C/G]TTTCTCCACATAGGGTGTCCCCGAA
    Chromosome:
    4:117918135
    Gene:
    INSIG1 (GeneView)
    Functional Consequence:
    intron variant,utr variant 3 prime
    Validated:
    by cluster

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center