Display Settings:

Format

Send to:

Choose Destination
1.

rs2477686 [Homo sapiens]
    TGGCTGCTGCATGCGGGCACAGAAT[C/G]TAGGTCAGGCTGTTGCAGGGGGGTA
    Chromosome:
    1:2461209
    Gene:
    PLCH2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    G=0.2608/1306
    HGVS:
    CM000663.2:g.2461209G>C, NC_000001.10:g.2392648G>C, NC_000001.11:g.2461209G>C, NT_187515.1:g.12399G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center