Display Settings:

Format

Send to:

Choose Destination
1.

rs207482177 [Homo sapiens]
    GCAGAAGACACACTGTGTGCCTGTA[A/G]TCAGAGCCAGTTAACACCTTTGGCT
    Chromosome:
    Y:26573323
    Allele Origin:
    G(somatic)/A(germline,somatic)
    Validated:
    no info
    HGVS:
    NC_000024.10:g.26573323A>G, NC_000024.9:g.28719470A>G, NG_002820.2:g.9432A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center