Display Settings:

Format

Send to:

Choose Destination
1.

rs207459999 [Homo sapiens]
    GACAGACCTAGTTCAATGAATCTGA[A/G]GAGGCTACTCAGTAGACAGTCCCAC
    Chromosome:
    MT:15242
    Gene:
    CYTB (GeneView)
    Functional Consequence:
    stop gained
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_012920.1:m.15242G>A, YP_003024038.1:p.Gly166Ter

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center