Display Settings:

Format

Send to:

Choose Destination
1.

rs202055315 [Homo sapiens]
    CTAGAAGGAAGGTTTTTGAGAAACT[A/C]CTTTGTGATGTGTGAATGAATCTCA
    Chromosome:
    Y:10203975
    Allele Origin:
    A(germline)/C(germline,somatic)
    Validated:
    by cluster
    HGVS:
    CM000686.2:g.10203975A>C, NC_000024.10:g.10203975A>C, NC_000024.9:g.10041584A>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center