Display Settings:

Format

Send to:

Choose Destination
1.

rs201777848 [Homo sapiens]
    GGCGGCTGGGGCTGCGGCTGCTGCT[
    -/GCTGCGGCTGCG
    ]GCTGCGGCGGCGGCTGGGGCTGCGG
    Chromosome:
    11:44309738
    Gene:
    ALX4 (GeneView)
    Functional Consequence:
    cds indel
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    -=0.0286/143
    HGVS:
    NC_000011.10:g.44309738_44309749delGCTGCGGCTGCG, NC_000011.9:g.44331288_44331299delGCTGCGGCTGCG, NG_015809.1:g.5418_5429delCGCAGCCGCAGC, NM_021926.3:c.314_325delCGCAGCCGCAGC, NP_068745.2:p.Pro105_Gln108del, XR_242817.1:n.437_448delCGCAGCCGCAGC

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center