Display Settings:

Format

Send to:

Choose Destination
1.

rs200245777 [Homo sapiens]
    AAAGAAAAAGAAAGGAAAGTGTGAT[C/G/T]TGAGTCTTTCTAGAAGGTTTCATCT
    Chromosome:
    Y:11771258
    Allele Origin:
    G(germline)/T(germline,somatic)
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.0073/9
    HGVS:
    NC_000024.10:g.11771258G>C, NC_000024.10:g.11771258G>T, NC_000024.9:g.13891964G>C, NC_000024.9:g.13891964G>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center