Display Settings:

Format

Send to:

Choose Destination
1.

rs199790958 [Homo sapiens]
    CTCTAATCATCTTTATGTTCTGCGC[A/G]ATGGTTATCACCATCGTTGTAGACC
    Chromosome:
    X:151176823
    Gene:
    GPR50-AS1 (GeneView) GPR50 (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Allele Origin:
    G(germline)/A(germline,somatic)
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000023.10:g.150345295G>A, NC_000023.11:g.151176823G>A, NG_016405.1:g.5240G>A, NM_004224.3:c.102G>A, NP_004215.2:p.Ala34, NR_135300.1:n.513C>T, XM_005274772.1:c.102G>A, XP_005274829.1:p.Ala34

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center