Display Settings:

Format

Send to:

Choose Destination
1.

rs199625352 [Homo sapiens]
    TCAATAACCAGATAGAACCAGCAGA[C/G/T]GAAAGAATTTCAGAGTTTGAAGACT
    Chromosome:
    Y:4320603
    Allele Origin:
    G(somatic)/T(germline,somatic)
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000024.10:g.4320603T>C, NC_000024.10:g.4320603T>G, NC_000024.9:g.4188644T>C, NC_000024.9:g.4188644T>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center