Display Settings:

Format

Send to:

Choose Destination
1.

rs193922466 [Homo sapiens]
    GACGAGGACGGGCAGACCAAGCTGA[A/G]ACAGAGGCGCAGCCGCACCAACTTC
    Chromosome:
    Y:634687
    Gene:
    SHOX (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Likely pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000023.10:g.595422A>G, NC_000023.11:g.634687A>G, NC_000024.10:g.634687A>G, NC_000024.9:g.545422A>G, NG_009385.2:g.15344A>G, NM_000451.3:c.347A>G, NM_006883.2:c.347A>G, NP_000442.1:p.Lys116Arg, NP_006874.1:p.Lys116Arg, XR_247282.1:n.1038A>G, XR_247322.1:n.1038A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center