Display Settings:

Format

Send to:

Choose Destination
1.

rs193922459 [Homo sapiens]
    CATAATGTTGACCTCAAGTTGAAGG[C/G]TAAGTTTCTACTGGGGTTTGGTGAT
    Chromosome:
    X:22047212
    Gene:
    PHEX (GeneView)
    Functional Consequence:
    splice donor variant
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Likely pathogenic
    Validated:
    no info
    HGVS:
    NC_000023.10:g.22065330G>C, NC_000023.11:g.22047212G>C, NG_007563.2:g.19410G>C, NM_000444.5:c.349+1G>C, NM_001282754.1:c.349+1G>C, XM_017029579.1:c.-94+1G>C, XR_001755695.1:n.1028+1G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center