Display Settings:

Format

Send to:

Choose Destination
1.

rs193922447 [Homo sapiens]
    CCTTCATTCTCTTTGTTTCTCTTCT[C/T]TGCCCTTTTCAGCGATTCACACCAT
    Chromosome:
    X:37793652
    Gene:
    CYBB (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Uncertain significance
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0003/1
    HGVS:
    NC_000023.10:g.37652905C>T, NC_000023.11:g.37793652C>T, NG_009065.1:g.18632C>T, NM_000397.3:c.338-13C>T, NW_003871099.1:g.505458C>T, XM_005272588.1:c.242-13C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center