Display Settings:

Format

Send to:

Choose Destination
1.

rs193922348 [Homo sapiens]
    ACCACATATGCACACATATCTCCAG[C/T]GATCCCCTGGGCTCCAGAGAACCTA
    Chromosome:
    X:71110295
    Gene:
    IL2RG (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    no info
    HGVS:
    NC_000023.10:g.70330145A>G, NC_000023.11:g.71110295A>G, NG_009088.1:g.6259T>C, NG_021141.1:g.1494T>C, NM_000206.2:c.455T>C, NP_000197.1:p.Val152Ala, XM_005262261.1:c.392T>C, XM_005262262.1:c.25-905T>C, XP_005262318.1:p.Val131Ala

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center