Display Settings:

Format

Send to:

Choose Destination
1.

rs183617006 [Homo sapiens]
    AAAAAAGTAGAATGTTATTTCAAAA[A/G]TTTGTAATATTTGAAAAAAAAGTAG
    Chromosome:
    6:32662550
    Gene:
    HLA-DQB1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0777/389
    HGVS:
    CM000668.2:g.32662550G>A, NC_000006.11:g.32630327G>A, NC_000006.12:g.32662550G>A, NM_001243961.1:c.380-302C>T, NM_002123.4:c.380-302C>T, NT_167245.2:g.3903362G>A, NT_167247.2:g.3958907G>A, NT_167249.2:g.4059765G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center