Display Settings:

Format

Send to:

Choose Destination
1.

rs16822373 has merged into rs2856982 [Homo sapiens]
    AAAAAACTCCAGTTGACACAAAATA[A/C/G/T]ACTACGAAAGTGGCTTTAACATATC
    Chromosome:
    MT:1018
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Benign
    Validated:
    by cluster,by frequency
    HGVS:
    NC_012920.1:m.1018G>A, NC_012920.1:m.1018G>C, NC_012920.1:m.1018G>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center