Display Settings:

Format

Send to:

Choose Destination
1.

rs155505585 [Gorilla gorilla]
    CTTCAGAGTCAAAGGCCAGAGAGCA[A/C/G/T]GGAGCTGAGTGGAGCCACCATGGCC
    Chromosome:
    9:118552793
    Gene:
    FCN1 (GeneView)
    Functional Consequence:
    utr variant 5 prime
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center