Display Settings:

Format

Send to:

Choose Destination
1.

rs112332167 has merged into rs28358571 [Homo sapiens]
    TCAAAGGACCTGGCGGTGCTTCATA[C/T]CCCTCTAGAGGAGCCTGTTCTGTAA
    Chromosome:
    MT:1189
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Benign
    Validated:
    by cluster,by frequency
    HGVS:
    NC_012920.1:m.1189T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center