Display Settings:

Format

Send to:

Choose Destination
1.

rs111033587 has merged into rs35315638 [Homo sapiens]
    CTCCTAGTCCAGACGCCATGGGTCA[G/T]TTCACAGAGGAGGACAAGGCTACTA
    Chromosome:
    11:5249796
    Gene:
    HBG1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/T(germline)
    Clinical significance:
    other
    Validated:
    by cluster
    HGVS:
    NC_000011.10:g.5249796A>C, NC_000011.9:g.5271026A>C, NG_000007.3:g.47820T>G, NM_000559.2:c.9T>G, NP_000550.2:p.His3Gln

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center