Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My NCBI Filters

Results by year

Table representation of search results timeline featuring number of search results per year.

Year Number of Results
1949 1
1957 1
1965 1
1969 1
1971 1
1972 1
1974 1
1978 1
1979 2
1983 2
1984 4
1989 2
1991 5
1992 1
1993 1
1994 2
1995 5
1996 1
1997 3
1998 8
1999 11
2000 9
2001 4
2002 10
2003 4
2004 13
2005 8
2006 16
2007 13
2008 5
2009 12
2010 7
2011 13
2012 8
2013 11
2014 7
2015 7
2016 1
2017 5
2018 8
2019 5
2020 6
2021 3
2022 4
2023 4
2024 2

Text availability

Article attribute

Article type

Publication date

Search Results

223 results

Results by year

Filters applied: . Clear all
Page 1
Etelcalcetide.
[No authors listed] [No authors listed] 2023 Aug 15. Drugs and Lactation Database (LactMed®) [Internet]. Bethesda (MD): National Institute of Child Health and Human Development; 2006–. 2023 Aug 15. Drugs and Lactation Database (LactMed®) [Internet]. Bethesda (MD): National Institute of Child Health and Human Development; 2006–. PMID: 37603680 Free Books & Documents. Review.
Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study.
Liu L, Stepanian L, Dubins DN, Chalikian TV. Liu L, et al. J Phys Chem B. 2018 Aug 9;122(31):7647-7653. doi: 10.1021/acs.jpcb.8b03912. Epub 2018 Jul 31. J Phys Chem B. 2018. PMID: 30011203
We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. ...
We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24- …
L-argininamide improves the refolding more effectively than L-arginine.
Hamada H, Shiraki K. Hamada H, et al. J Biotechnol. 2007 Jun 15;130(2):153-60. doi: 10.1016/j.jbiotec.2007.03.003. Epub 2007 Mar 12. J Biotechnol. 2007. PMID: 17434637 Free article.
The refolding yield of hen egg lysozyme in the presence of 500 mM L-argininamide (ArgAd) increases 1.7-fold higher than Arg. Thermal unfolding experiments indicate that ArgAd has a greater denaturing effect than Arg. ...
The refolding yield of hen egg lysozyme in the presence of 500 mM L-argininamide (ArgAd) increases 1.7-fold higher than Arg. Thermal …
Argininamide-type neuropeptide Y Y(1) receptor antagonists: the nature of N (omega)-carbamoyl substituents determines Y(1)R binding mode and affinity.
Buschmann J, Seiler T, Bernhardt G, Keller M, Wifling D. Buschmann J, et al. RSC Med Chem. 2020 Jan 20;11(2):274-282. doi: 10.1039/c9md00538b. eCollection 2020 Feb 1. RSC Med Chem. 2020. PMID: 33479634 Free PMC article.
The recently resolved crystal structure of the neuropeptide Y Y(1) receptor (Y(1)R), co-crystallized with the high-affinity (pK (i): 10.11), argininamide-type Y(1)R antagonist UR-MK299 (2), revealed that the N (omega)-carbamoyl substituent (van der Waals volume: 139 A(3)) …
The recently resolved crystal structure of the neuropeptide Y Y(1) receptor (Y(1)R), co-crystallized with the high-affinity (pK (i): 10.11), …
Argininamide binding arrests global motions in HIV-1 TAR RNA: comparison with Mg2+-induced conformational stabilization.
Pitt SW, Majumdar A, Serganov A, Patel DJ, Al-Hashimi HM. Pitt SW, et al. J Mol Biol. 2004 Apr 16;338(1):7-16. doi: 10.1016/j.jmb.2004.02.031. J Mol Biol. 2004. PMID: 15050819 Free PMC article.
The structure and dynamics of the stem-loop transactivation response element (TAR) RNA from the human immunodeficiency virus type-1 (HIV-1) bound to the ligand argininamide (ARG) has been characterized using a combination of a large number of residual dipolar couplings (RD …
The structure and dynamics of the stem-loop transactivation response element (TAR) RNA from the human immunodeficiency virus type-1 (HIV-1) …
Dimeric argininamide-type neuropeptide Y receptor antagonists: chiral discrimination between Y1 and Y4 receptors.
Keller M, Kaske M, Holzammer T, Bernhardt G, Buschauer A. Keller M, et al. Bioorg Med Chem. 2013 Nov 1;21(21):6303-22. doi: 10.1016/j.bmc.2013.08.065. Epub 2013 Sep 8. Bioorg Med Chem. 2013. PMID: 24074877
In this work, the structures of the high affinity selective (R)-argininamide-type Y1R antagonists BIBP3226 and BIBO3304 were linked via the guanidine or urea moieties to give homo-dimeric argininamides with linker lengths ranging from 31 to 41 atoms. ...
In this work, the structures of the high affinity selective (R)-argininamide-type Y1R antagonists BIBP3226 and BIBO3304 were linked v …
Red-fluorescent argininamide-type NPY Y1 receptor antagonists as pharmacological tools.
Keller M, Erdmann D, Pop N, Pluym N, Teng S, Bernhardt G, Buschauer A. Keller M, et al. Bioorg Med Chem. 2011 May 1;19(9):2859-78. doi: 10.1016/j.bmc.2011.03.045. Epub 2011 Apr 12. Bioorg Med Chem. 2011. PMID: 21493077
Fluorescently labelled NPY Y(1) receptor (Y(1)R) ligands were synthesized by connecting pyrylium and cyanine dyes with the argininamide-type Y(1)R antagonist core structure by linkers, covering a wide variety in length and chemical nature, attached to the guanidine group. …
Fluorescently labelled NPY Y(1) receptor (Y(1)R) ligands were synthesized by connecting pyrylium and cyanine dyes with the argininamide …
Toward Labeled Argininamide-Type NPY Y1 Receptor Antagonists: Identification of a Favorable Propionylation Site in BIBO3304.
Keller M, Schindler L, Bernhardt G, Buschauer A. Keller M, et al. Arch Pharm (Weinheim). 2015 Jun;348(6):390-8. doi: 10.1002/ardp.201400427. Epub 2015 Apr 17. Arch Pharm (Weinheim). 2015. PMID: 25884646
Aiming at molecular tools for the neuropeptide Y Y1 receptor (Y1 R), three types of derivatives of the argininamide-type Y1 R antagonist BIBO3304 were prepared by (i) propionylation at the guanidine group (3), (ii) substitution at the urea moiety with a propionamidobutyl r …
Aiming at molecular tools for the neuropeptide Y Y1 receptor (Y1 R), three types of derivatives of the argininamide-type Y1 R antagon …
Prototypic (18)F-Labeled Argininamide-Type Neuropeptide Y Y(1)R Antagonists as Tracers for PET Imaging of Mammary Carcinoma.
Keller M, Maschauer S, Brennauer A, Tripal P, Koglin N, Dittrich R, Bernhardt G, Kuwert T, Wester HJ, Buschauer A, Prante O. Keller M, et al. ACS Med Chem Lett. 2017 Feb 21;8(3):304-309. doi: 10.1021/acsmedchemlett.6b00467. eCollection 2017 Mar 9. ACS Med Chem Lett. 2017. PMID: 28337321 Free PMC article.
The neuropeptide Y (NPY) Y(1) receptor (Y(1)R) selective radioligand (R)-N(alpha)-(2,2-diphenylacetyl)-N(omega)-[4-(2-[(18)F]fluoropropanoylamino)butyl]aminocarbonyl-N-(4-hydroxybenzyl)argininamide ([(18)F]23), derived from the high-affinity Y(1)R antagonist BIBP3226, was …
The neuropeptide Y (NPY) Y(1) receptor (Y(1)R) selective radioligand (R)-N(alpha)-(2,2-diphenylacetyl)-N(omega)-[4-(2-[(18)F]fluoropropanoyl …
Computational docking simulations of a DNA-aptamer for argininamide and related ligands.
Albada HB, Golub E, Willner I. Albada HB, et al. J Comput Aided Mol Des. 2015 Jul;29(7):643-54. doi: 10.1007/s10822-015-9844-5. Epub 2015 Apr 16. J Comput Aided Mol Des. 2015. PMID: 25877490
In the present study we apply molecular docking simulations to probe the features of an experimentally documented L-argininamide aptamer complex. The docking simulations were performed using AutoDock 4.0 and YASARA Structure software, a well-suited program for following in …
In the present study we apply molecular docking simulations to probe the features of an experimentally documented L-argininamide apta …
223 results