Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My NCBI Filters

Results by year

Table representation of search results timeline featuring number of search results per year.

Year Number of Results
1992 1
1994 1
1995 6
1996 4
1997 5
1998 1
1999 4
2000 1
2003 1
2005 1
2006 1
2007 1
2008 1
2009 1
2010 1
2011 1
2012 2
2013 1
2015 1
2020 1
2021 1
2024 0

Text availability

Article attribute

Article type

Publication date

Search Results

35 results

Results by year

Filters applied: . Clear all
Page 1
Pharmacokinetics and tolerability of intravenous trecovirsen (GEM 91), an antisense phosphorothioate oligonucleotide, in HIV-positive subjects.
Séréni D, Tubiana R, Lascoux C, Katlama C, Taulera O, Bourque A, Cohen A, Dvorchik B, Martin RR, Tournerie C, Gouyette A, Schechter PJ. Séréni D, et al. J Clin Pharmacol. 1999 Jan;39(1):47-54. doi: 10.1177/00912709922007552. J Clin Pharmacol. 1999. PMID: 9987700 Clinical Trial.
Trecovirsen, a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene, was administered to HIV-positive volunteers as an i.v. infusion. ...Thus, trecovirsen administration was well tolerated in single i.v. doses up to 2.5 mg/kg... …
Trecovirsen, a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene, was administered to HIV-po …
Mitigation of analyte loss on metal surfaces in liquid chromatography.
Gilar M, DeLano M, Gritti F. Gilar M, et al. J Chromatogr A. 2021 Aug 2;1650:462247. doi: 10.1016/j.chroma.2021.462247. Epub 2021 May 19. J Chromatogr A. 2021. PMID: 34087520 Free article.
Losses were observed for adenosine 5'-(alpha,beta-methylene) diphosphate, 2-pyridinol 1-oxide and the 25-mer phosphorothioate oligonucleotide Trecovirsen (GEM91) on stainless steel and titanium frits. Analyte adsorption was greatest at acidic pH due to the positive …
Losses were observed for adenosine 5'-(alpha,beta-methylene) diphosphate, 2-pyridinol 1-oxide and the 25-mer phosphorothioate oligonucleotid …
Pharmacokinetics of antisense oligonucleotides.
Agrawal S, Temsamani J, Galbraith W, Tang J. Agrawal S, et al. Clin Pharmacokinet. 1995 Jan;28(1):7-16. doi: 10.2165/00003088-199528010-00002. Clin Pharmacokinet. 1995. PMID: 7712663 Review.
Was induction of HIV-1 through TLR9?
Agrawal S, Martin RR. Agrawal S, et al. J Immunol. 2003 Aug 15;171(4):1621; author reply 1621-2. doi: 10.4049/jimmunol.171.4.1621. J Immunol. 2003. PMID: 12902456 No abstract available.
Analysis of interaction between dendriplexes and bovine serum albumin.
Shcharbin D, Pedziwiatr E, Chonco L, Bermejo-Martín JF, Ortega P, de la Mata FJ, Eritja R, Gómez R, Klajnert B, Bryszewska M, Muñoz-Fernandez MA. Shcharbin D, et al. Biomacromolecules. 2007 Jul;8(7):2059-62. doi: 10.1021/bm070333p. Epub 2007 Jun 21. Biomacromolecules. 2007. PMID: 17583948
Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluoresce …
Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interacti …
35 results