GEO Profiles for Gene (Select 66169) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 4026

<< First< Prev

Page of 202

Next >Last >>

Select item 1311806211.

Tomm7 - FLT3/ITD-SmoM2 acute myeloid leukemia model: sorted bone marrow cells

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1261, 1428215_x_at (ID_REF), GDS5806, 66169 (Gene ID), BB609428

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131180621

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1151609212.

Tomm7 - Running effect on hippocampal subgranular zone: time course

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL81, 160256_at (ID_REF), GDS5005, 66169 (Gene ID), AA611709

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 115160921

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441639153.

Tomm7 - Testis response to histone deacetylase inhibitor trichostatin A: time course

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL4053, 9315 (ID_REF), GDS2923, AK003864

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 44163915

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 395729144.

Tomm7 - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1524, 1114 (ID_REF), GDS2747, AK003864

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39572914

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 91909485.

Tomm7 - Skeletal muscle response to voluntary running: time course

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL254, 13220 (ID_REF), GDS1019, AK003864

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9190948

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 22246216.

Tomm7 - Hypothalamus response to lipopolysaccharide and restraint stress

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL81, 160256_at (ID_REF), GDS324, 66169 (Gene ID), AA611709

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 2224621

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1158161387.

Tomm7 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1261, 1434732_x_at (ID_REF), GDS5114, 66169 (Gene ID), AV044898

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115816138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1131389218.

Tomm7 - An in vitro primordial germ cell specification system: time course

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1261, 1428215_x_at (ID_REF), GDS4870, 66169 (Gene ID), BB609428

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 113138921

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1131389209.

Tomm7 - An in vitro primordial germ cell specification system: time course

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1261, 1428214_at (ID_REF), GDS4870, 66169 (Gene ID), BB609428

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 113138920

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10870512710.

Tomm7 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10528523 (ID_REF), GDS4973, NM_025394, BC055352, chr5:23839652-23844123 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108705127

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9715367611.

Tomm7 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL9734, 100109441_TGI_at (ID_REF), GDS4495, NM_025394

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97153676

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4140488512.

Tomm7 - Nephronophthisis model

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL2897, 107013 (ID_REF), GDS2817, NM_025394

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41404885

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2161812113.

Tomm7 - Testes of various subspecies

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL81, 160256_at (ID_REF), GDS1884, 66169 (Gene ID), AA611709

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 21618121

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 986642114.

Tomm7 - Hematopoietic stem cells from different recombinant inbred strains

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL81, 160256_at (ID_REF), GDS1077, 66169 (Gene ID), AA611709

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 9866421

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761002015.

Tomm7 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAACATGGAAGGTGTA (ID_REF), GDS878, BC055352

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7610020

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 665782116.

Tomm7 - Preimplantation embryo development (MG-U74A)

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL81, 160256_at (ID_REF), GDS812, 66169 (Gene ID), AA611709

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 6657821

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 123812117.

Tomm7 - Hyperoxic lung injury (U74Av2)

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL81, 160256_at (ID_REF), GDS247, 66169 (Gene ID), AA611709

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 1238121

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12716222018.

Tomm7 - UTX deficiency effect on embryonic stem cells

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1261, 1428214_at (ID_REF), GDS5465, 66169 (Gene ID), BB609428

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 127162220

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12335631719.

Tomm7 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2499944 (ID_REF), GDS5360, NM_025394, TOMM7 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123356317

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12120052020.

Tomm7 - Fezf2 overexpresson effect on cortical neural progenitors in vivo: time course

Annotation:: Tomm7, translocase of outer mitochondrial membrane 7 homolog (yeast)

Organism:: Mus musculus

Reporter:: GPL1261, 1428214_at (ID_REF), GDS5297, 66169 (Gene ID), BB609428

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 121200520

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 202

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles for Gene (Select 66169) (4026)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 4026

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity