GEO Profiles for Gene (Select 233878) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2218

<< First< Prev

Page of 111

Next >Last >>

Select item 560931681.

Sez6l2 - Amyotrophic lateral sclerosis model

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL339, 1434641_x_at (ID_REF), GDS3408, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 56093168

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 146901282.

Sez6l2 - Transcription factor Tcf1 knockout effect on pancreatic islets (MG-U74B)

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL82, 117336_at (ID_REF), GDS1474, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 14690128

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1142491473.

Sez6l2 - Glucose effect on young and aged pancreatic islets: dose response

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS4939, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 114249147

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1025858474.

Sez6l2 - Latent gammaherpesvirus 68 infection of various organs

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS4775, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, transformed count, 28 samples

ID:: 102585847

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 683211475.

Sez6l2 - von Hippel-Lindau (VHL) tumor suppressor protein deficiency effect on pancreatic islet cells

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS3800, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 68321147

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214375676.

Sez6l2 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1792, M200013049 (ID_REF), GDS1874, BC011475

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21437567

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74876027.

Sez6l2 - MPSS transcriptome analysis project

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCGGGTCCCCAAATGCGC (ID_REF), GDS868, BC011475

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487602

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1216263478.

Sez6l2 - Antidepressant fluoxetine effect on depression model: ventral dentate gyrus

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS5308, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121626347

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1215798479.

Sez6l2 - Antidepressant fluoxetine effect on depression model: dorsal dentate gyrus

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS5307, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121579847

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11423848910.

Sez6l2 - Glucose effect on young and aged pancreatic islets: dose response

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1423983_at (ID_REF), GDS4939, 233878 (Gene ID), BC011475

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 114238489

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10440524711.

Sez6l2 - Platelet-derived growth factor receptor alpha-driven pediatric glioblastoma model with p53 null background

Annotation:: Sez6l2, Seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL11180, 1434641_PM_x_at (ID_REF), GDS4821, AW121511

DataSet type:: Expression profiling by array, transformed count, 45 samples

ID:: 104405247

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10317474712.

Sez6l2 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Sez6l2, Seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL11180, 1434641_PM_x_at (ID_REF), GDS4791, AW121511

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103174747

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7660594713.

Sez6l2 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS4034, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76605947

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7061404714.

Sez6l2 - Embryonic development of male reproductive tract tissues

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS3862, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70614047

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5527342815.

Sez6l2 - Visual cortex during the critical period for ocular dominance (MG-U74B)

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL82, 117336_at (ID_REF), GDS3376, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55273428

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4879496816.

Sez6l2 - Suprachiasmatic nucleus response to a light pulse

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL8321, 1434641_x_at (ID_REF), GDS3107, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 48794968

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4545164717.

Sez6l2 - Vitamin E supplementation effect on aged brain

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1434641_x_at (ID_REF), GDS2973, 233878 (Gene ID), AW121511

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45451647

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4544098918.

Sez6l2 - Vitamin E supplementation effect on aged brain

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1423983_at (ID_REF), GDS2973, 233878 (Gene ID), BC011475

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45440989

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4318678919.

Sez6l2 - Cerebral cortex and hypothalamus response to sleep and sleep deprivation: time course

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL1261, 1423983_at (ID_REF), GDS2882, 233878 (Gene ID), BC011475

DataSet type:: Expression profiling by array, count, 90 samples

ID:: 43186789

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2852012020.

Sez6l2 - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Sez6l2, seizure related 6 homolog like 2

Organism:: Mus musculus

Reporter:: GPL2987, 7420 (ID_REF), GDS2227, BC011475

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28520120

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 111

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles for Gene (Select 233878) (2218)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2218

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity