GEO Profiles for Gene (Select 12794) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1463

<< First< Prev

Page of 74

Next >Last >>

Select item 974303861.

Cnih2 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10464917 (ID_REF), GDS4517, NM_009920, AB006191, BC103797, BC137585, BC137586, chr19:5092871-5098507 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97430386

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 225779902.

Cnih2 - Various tissues from somatic clones

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL2026, 4990 (ID_REF), GDS1943, NM_009920

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 22577990

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968319863.

Cnih2 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10464917 (ID_REF), GDS4486, NM_009920, AB006191, BC103797, BC137585, BC137586, chr19:5092871-5098507 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96831986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 335074554.

Cnih2 - Ras-associated binding protein 3A mutations effect on brain cortices and hippocampi (MG-430A)

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL339, 1417524_at (ID_REF), GDS2482, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 33507455

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 221048555.

Cnih2 - Inhibitor-1 knockout effect on the hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417524_at (ID_REF), GDS1920, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22104855

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 218430956.

Cnih2 - Classical fear conditioning effect on amygdala and hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS1903, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 21843095

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75171817.

Cnih2 - MPSS transcriptome analysis project

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGAAATACTGGGCA (ID_REF), GDS868, BC059922

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7517181

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1244262558.

Cnih2 - Neuron-specific T-box transcription factor deficiency effect on embryonic day 16.5 forebrains

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417524_at (ID_REF), GDS5389, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124426255

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 725966559.

Cnih2 - Various central nervous system regions of adult inbred strain

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417524_at (ID_REF), GDS3917, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, transformed count, 102 samples

ID:: 72596655

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6569125510.

Cnih2 - Zinc finger Zbtb20 deficiency effect on the developing hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417524_at (ID_REF), GDS3718, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 65691255

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4396845511.

Cnih2 - Various brain regions of several inbred strains

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417524_at (ID_REF), GDS2917, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43968455

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2177085512.

Cnih2 - Strains exhibiting low or high freezing in response to fear: amygdala and hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417524_at (ID_REF), GDS1901, 12794 (Gene ID), NM_009920

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 21770855

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 474999513.

Cnih2 - Neurofibromatosis and neurodevelopment

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS604, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 4749995

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 81377214.

Cnih2 - Dietary effects of long chain polyunsaturated fatty acids (Mu11K-A)

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL75, AB006191_at (ID_REF), GDS168, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 813772

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2850439515.

Cnih2 - Hippocampus of various inbred strains

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS2226, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 28504395

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1908769516.

Cnih2 - Succinate semialdehyde dehydrogenase deficiency effect on the brain

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS1745, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 19087695

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1533789517.

Cnih2 - Embryonal carcinoma cell line response to retinoic acid or trichostatin A

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS1512, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 15337895

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1027589518.

Cnih2 - RNA binding protein HuD overexpression effect on hippocampus

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS1111, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 10275895

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 664549519.

Cnih2 - Amyloid precursor protein mutant overexpression in strain resistant to neuronal cell loss

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS811, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 6645495

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 96649520.

Cnih2 - Contextual fear conditioning paradigm

Annotation:: Cnih2, cornichon family AMPA receptor auxiliary protein 2

Organism:: Mus musculus

Reporter:: GPL81, 160830_at (ID_REF), GDS200, 12794 (Gene ID), AB006191

DataSet type:: Expression profiling by array, count, 64 samples

ID:: 966495

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 74

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles for Gene (Select 12794) (1463)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1463

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity