GEO Profiles for Gene (Select 108841) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1821

<< First< Prev

Page of 92

Next >Last >>

Select item 824530701.

Rdh13 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2764201 (ID_REF), GDS3720, NM_175372

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82453070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 706132052.

Rdh13 - Embryonic development of male reproductive tract tissues

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS3862, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70613205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529562583.

Rdh13 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL2872, 9858 (ID_REF), GDS3259, AK089458, A_52_P269334 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52956258

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1158152054.

Rdh13 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS5114, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115815205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 597572055.

Rdh13 - Skeletal muscle response to myostatin inhibition

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS3526, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 59757205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619223056.

Rdh13 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS3598, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61922305

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 470577057.

Rdh13 - Matrix metalloproteinase mutant airway epithelial cells response to Pseudomonas aeruginosa infection: time course

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS3040, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 47057705

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 245131588.

Rdh13 - 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-lesioned substantia nigra: time course

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL32, 98669_f_at (ID_REF), GDS2053, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 24513158

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 180423059.

Rdh13 - Transcription factor Nrl deficiency effect on photoreceptor development

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS1693, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 18042305

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12199630510.

Rdh13 - Lysine-specific demethylase 1 deficiency effect on developing trophoblast stem cells: time course

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS5319, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 121996305

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5538875211.

Rdh13 - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL891, 13052 (ID_REF), GDS3386, NM_175372, A_51_P513071 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55388752

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8723290512.

Rdh13 - Protein kinase C (PKC)ζ knockout response to chronic angiotensin treatment in vivo: heart

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS4310, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 87232905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5756380513.

Rdh13 - PPARalpha deficient heart response to chronic pressure overload

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS3465, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 57563805

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761416014.

Rdh13 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAACTCAGTTAGGCTT (ID_REF), GDS878, NM_175372

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7614160

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4140126015.

Rdh13 - Nephronophthisis model

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL2897, 74084 (ID_REF), GDS2817, NM_175372

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41401260

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 104029316.

Rdh13 - Platform type/amplification method cross comparison (16K cDNA)(I)

Annotation:: Rdh13, Retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL260, 6302 (ID_REF), GDS224, BF540693

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1040293

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7232330517.

Rdh13 - Oral mucosal adaptive immune model: time course

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS3909, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 72323305

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10236460518.

Rdh13 - Cmah knockout effect on mdx model of Duchenne Muscular Dystrophy (DMD): cardiac muscle

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS4770, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 102364605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9287760519.

Rdh13 - Inositol 1,4,5-trisphosphate receptor type 1 and type 3 double knockouts: embryonic heart

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL1261, 1433799_at (ID_REF), GDS4450, 108841 (Gene ID), AV366849

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 92877605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7284383120.

Rdh13 - Spatial and temporal development of mammalian salivary glands

Annotation:: Rdh13, retinol dehydrogenase 13 (all-trans and 9-cis)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P269334 (ID_REF), GDS3922, AK089458, A_52_P269334 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72843831

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 92

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles for Gene (Select 108841) (1821)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1821

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity