Format
Sort by
Items per page

Send to

Choose Destination

Search results

Items: 1 to 50 of 149

1.

Morphea With Keloidal Features: A Case Report and Review of the Literature.

Yu D, Ibarra BS, Akkurt ZM, Ahn C, Sangüeza OP.

Am J Dermatopathol. 2020 Mar 6. doi: 10.1097/DAD.0000000000001629. [Epub ahead of print]

PMID:
32149834
2.

Dynamic constriction and fission of endoplasmic reticulum membranes by reticulon.

Espadas J, Pendin D, Bocanegra R, Escalada A, Misticoni G, Trevisan T, Velasco Del Olmo A, Montagna A, Bova S, Ibarra B, Kuzmin PI, Bashkirov PV, Shnyrova AV, Frolov VA, Daga A.

Nat Commun. 2019 Nov 22;10(1):5327. doi: 10.1038/s41467-019-13327-7.

3.

Replicative DNA polymerases promote active displacement of SSB proteins during lagging strand synthesis.

Cerrón F, de Lorenzo S, Lemishko KM, Ciesielski GL, Kaguni LS, Cao FJ, Ibarra B.

Nucleic Acids Res. 2019 Jun 20;47(11):5723-5734. doi: 10.1093/nar/gkz249.

4.

From mycosis fungoides to herpetic folliculitis: The significance of deeper H&E tissue sections in dermatopathology.

Ibarra BS, Huen A, Nagarajan P, Torres-Cabala CA, Prieto VG, Aung PP.

J Cutan Pathol. 2019 Aug;46(8):624-626. doi: 10.1111/cup.13456. Epub 2019 Apr 17. No abstract available.

PMID:
30883857
5.

Polylactic-co-glycolic acid microspheres added to fixative cements and its role on bone infected architecture.

Ibarra B, García-García J, Azuara G, Vázquez-Lasa B, Ortega MA, Asúnsolo Á, San Román J, Buján J, García-Honduvilla N, De la Torre B.

J Biomed Mater Res B Appl Biomater. 2019 Nov;107(8):2517-2526. doi: 10.1002/jbm.b.34342. Epub 2019 Feb 19.

6.

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection.

Azuara G, García-García J, Ibarra B, Parra-Ruiz FJ, Asúnsolo A, Ortega MA, Vázquez-Lasa B, Buján J, San Román J, de la Torre B.

Rev Esp Cir Ortop Traumatol. 2019 Mar - Apr;63(2):95-103. doi: 10.1016/j.recot.2018.10.002. Epub 2019 Jan 2. English, Spanish.

PMID:
30611707
7.

Dynamics of individual molecular shuttles under mechanical force.

Naranjo T, Lemishko KM, de Lorenzo S, Somoza Á, Ritort F, Pérez EM, Ibarra B.

Nat Commun. 2018 Oct 30;9(1):4512. doi: 10.1038/s41467-018-06905-8.

8.

The 14-3-3 Protein Homolog ArtA Regulates Development and Secondary Metabolism in the Opportunistic Plant Pathogen Aspergillus flavus.

Ibarra BA, Lohmar JM, Satterlee T, McDonald T, Cary JW, Calvo AM.

Appl Environ Microbiol. 2018 Feb 14;84(5). pii: e02241-17. doi: 10.1128/AEM.02241-17. Print 2018 Mar 1.

9.

Wnt/β-catenin Signaling Pathway Regulates Specific lncRNAs That Impact Dermal Fibroblasts and Skin Fibrosis.

Mullin NK, Mallipeddi NV, Hamburg-Shields E, Ibarra B, Khalil AM, Atit RP.

Front Genet. 2017 Nov 21;8:183. doi: 10.3389/fgene.2017.00183. eCollection 2017.

10.

Mechanical measurement of hydrogen bonded host-guest systems under non-equilibrium, near-physiological conditions.

Naranjo T, Cerrón F, Nieto-Ortega B, Latorre A, Somoza Á, Ibarra B, Pérez EM.

Chem Sci. 2017 Sep 1;8(9):6037-6041. doi: 10.1039/c7sc03044d. Epub 2017 Jul 31.

11.

A Pilot Genome-Wide Association Study in Postmenopausal Mexican-Mestizo Women Implicates the RMND1/CCDC170 Locus Is Associated with Bone Mineral Density.

Villalobos-Comparán M, Jiménez-Ortega RF, Estrada K, Parra-Torres AY, González-Mercado A, Patiño N, Castillejos-López M, Quiterio M, Fernandez-López JC, Ibarra B, Romero-Hidalgo S, Salmerón J, Velázquez-Cruz R.

Int J Genomics. 2017;2017:5831020. doi: 10.1155/2017/5831020. Epub 2017 Aug 3.

12.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ.

Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. Epub 2017 Jun 12.

PMID:
28603845
13.

Antimicrobial susceptibility testing before first-line treatment for Helicobacter pylori infection in patients with dual or triple antibiotic resistance.

Cosme A, Montes M, Ibarra B, Tamayo E, Alonso H, Mendarte U, Lizasoan J, Herreros-Villanueva M, Bujanda L.

World J Gastroenterol. 2017 May 14;23(18):3367-3373. doi: 10.3748/wjg.v23.i18.3367.

14.

DNA synthesis determines the binding mode of the human mitochondrial single-stranded DNA-binding protein.

Morin JA, Cerrón F, Jarillo J, Beltran-Heredia E, Ciesielski GL, Arias-Gonzalez JR, Kaguni LS, Cao FJ, Ibarra B.

Nucleic Acids Res. 2017 Jul 7;45(12):7237-7248. doi: 10.1093/nar/gkx395.

15.

Mechanics, thermodynamics, and kinetics of ligand binding to biopolymers.

Jarillo J, Morín JA, Beltrán-Heredia E, Villaluenga JP, Ibarra B, Cao FJ.

PLoS One. 2017 Apr 5;12(4):e0174830. doi: 10.1371/journal.pone.0174830. eCollection 2017.

16.

Clarithromycin resistance in Helicobacter pylori and its molecular determinants in Northern Spain, 2013-2015.

Tamayo E, Montes M, Fernández-Reyes M, Lizasoain J, Ibarra B, Mendarte U, Zapata E, Mendiola J, Pérez-Trallero E.

J Glob Antimicrob Resist. 2017 Jun;9:43-46. doi: 10.1016/j.jgar.2016.12.019. Epub 2017 Mar 23.

PMID:
28343971
17.

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

Parra-Ruíz FJ, González-Gómez A, Fernández-Gutiérrez M, Parra J, García-García J, Azuara G, De la Torre B, Buján J, Ibarra B, Duocastella-Codina L, Molina-Crisol M, Vázquez-Lasa B, San Román J.

Int J Pharm. 2017 Apr 30;522(1-2):11-20. doi: 10.1016/j.ijpharm.2017.02.066. Epub 2017 Feb 28.

PMID:
28257884
18.

Respiratory distress associated with heterotopic gastrointestinal cysts of the oral cavity: A case report.

Méndez Sáenz MA, de Jesús Villegas González M, Ponce Camacho MA, Cavazos Cavazos LM, Ibarra BS, Esquivel García BI, Treviño González JL.

Ann Med Surg (Lond). 2016 Nov 12;12:43-46. eCollection 2016 Dec.

19.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

de-la-Cruz-Salcedo EI, Ibarra B, Rizo-de-la-Torre LC, Sánchez-López JY, González-Mercado A, Harteveld CL, Perea-Díaz FJ.

Int J Lab Hematol. 2016 Oct;38(5):535-42. doi: 10.1111/ijlh.12536. Epub 2016 Jun 24.

PMID:
27339814
20.

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

Titelbaum AR, Ibarra B, Naji S.

Int J Paleopathol. 2015 Jun;9:8-14. doi: 10.1016/j.ijpp.2014.11.004. Epub 2014 Dec 15.

PMID:
29539444
21.

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Torres-Jasso JH, Marín ME, Santiago-Luna E, Leoner JC, Torres J, Magaña-Torres MT, Perea FJ, Ibarra B, Sánchez-López JY.

Genet Mol Res. 2015 Mar 13;14(1):1802-7. doi: 10.4238/2015.March.13.8.

22.

Mechano-chemical kinetics of DNA replication: identification of the translocation step of a replicative DNA polymerase.

Morin JA, Cao FJ, Lázaro JM, Arias-Gonzalez JR, Valpuesta JM, Carrascosa JL, Salas M, Ibarra B.

Nucleic Acids Res. 2015 Apr 20;43(7):3643-52. doi: 10.1093/nar/gkv204. Epub 2015 Mar 23.

23.

5' and 3' β-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

Casas-Castañeda M, Ibarra B, Rizo-De La Torre LC, Sánchez-López JY, Magaña-Torres MT.

Am J Hum Biol. 2015 Sep-Oct;27(5):697-703. doi: 10.1002/ajhb.22691. Epub 2015 Mar 7.

PMID:
25753940
24.

Clarithromycin for first-line treatment of Helicobacter pylori infection after culture in high-resistance regions.

Martos M, Bujanda L, Salicio Y, Sarasqueta C, Ibarra B, Mendarte U, Fernández-Reyes M, Cosme A.

Eur J Gastroenterol Hepatol. 2014 Dec;26(12):1380-4. doi: 10.1097/MEG.0000000000000197.

PMID:
25229983
25.

[Risk factors for osteoporosis in postmenopausal women from Guadalajara, Jalisco].

González-Mercado A, Sánchez-López JY, Ibarra B.

Salud Publica Mex. 2013 Dec;55(6):627-30. Spanish.

PMID:
24715015
26.

First reported case of pneumonia caused by Cedecea lapagei in America.

Lopez LA, Ibarra BS, de la Garza JA, Rada Fde J, Nuñez AI, López MG.

Braz J Infect Dis. 2013 Sep-Oct;17(5):626-8. doi: 10.1016/j.bjid.2013.03.003. Epub 2013 Sep 11.

27.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

González-Mercado A, Sánchez-López JY, Regla-Nava JA, Gámez-Nava JI, González-López L, Duran-Gonzalez J, Celis A, Perea-Díaz FJ, Salazar-Páramo M, Ibarra B.

Genet Mol Res. 2013 Jul 30;12(3):2755-63. doi: 10.4238/2013.July.30.13.

28.

Impact of blood pressure changes and course on hematoma growth in acute intracerebral hemorrhage.

Rodriguez-Luna D, Piñeiro S, Rubiera M, Ribo M, Coscojuela P, Pagola J, Flores A, Muchada M, Ibarra B, Meler P, Sanjuan E, Hernandez-Guillamon M, Alvarez-Sabin J, Montaner J, Molina CA.

Eur J Neurol. 2013 Sep;20(9):1277-83. doi: 10.1111/ene.12180. Epub 2013 May 5.

PMID:
23647568
29.

Manipulation of single polymerase-DNA complexes: a mechanical view of DNA unwinding during replication.

Morin JA, Cao FJ, Valpuesta JM, Carrascosa JL, Salas M, Ibarra B.

Cell Cycle. 2012 Aug 15;11(16):2967-8. doi: 10.4161/cc.21389. Epub 2012 Aug 8. No abstract available.

30.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family.

Tintos-Hernández JA, Perea FJ, Ibarra B, Figuera LE.

West Indian Med J. 2012 Jan;61(1):81-3.

PMID:
22808571
31.

Active DNA unwinding dynamics during processive DNA replication.

Morin JA, Cao FJ, Lázaro JM, Arias-Gonzalez JR, Valpuesta JM, Carrascosa JL, Salas M, Ibarra B.

Proc Natl Acad Sci U S A. 2012 May 22;109(21):8115-20. doi: 10.1073/pnas.1204759109. Epub 2012 May 9.

32.

Usefulness of antimicrobial susceptibility in the eradication of Helicobacter pylori.

Cosme A, Montes M, Martos M, Gil I, Mendarte U, Salicio Y, Piñeiro L, Recasens MT, Ibarra B, Sarasqueta C, Bujanda L.

Clin Microbiol Infect. 2013 Apr;19(4):379-83. doi: 10.1111/j.1469-0691.2012.03844.x. Epub 2012 Apr 18.

33.

Regeneration of neuronal cell types in Schmidtea mediterranea: an immunohistochemical and expression study.

Fraguas S, Barberán S, Ibarra B, Stöger L, Cebrià F.

Int J Dev Biol. 2012;56(1-3):143-53. doi: 10.1387/ijdb.113428sf.

34.

Effect of glycine on the cyclooxygenase pathway of the kidney arachidonic acid metabolism in a rat model of metabolic syndrome.

Pérez-Torres I, Ibarra B, Soria-Castro E, Torrico-Lavayen R, Pavón N, Diaz-Diaz E, Flores PL, Infante O, Baños G.

Can J Physiol Pharmacol. 2011 Dec;89(12):899-910. doi: 10.1139/y11-086. Epub 2011 Nov 24.

PMID:
22115172
35.

Mechanical stability of low-humidity single DNA molecules.

Hormeño S, Ibarra B, Valpuesta JM, Carrascosa JL, Arias-Gonzalez JR.

Biopolymers. 2012 Apr;97(4):199-208. doi: 10.1002/bip.21728. Epub 2011 Oct 23.

PMID:
22020764
36.

Ultraearly hematoma growth predicts poor outcome after acute intracerebral hemorrhage.

Rodriguez-Luna D, Rubiera M, Ribo M, Coscojuela P, Piñeiro S, Pagola J, Hernandez-Guillamon M, Ibarra B, Romero F, Alvarez-Sabin J, Montaner J, Molina CA.

Neurology. 2011 Oct 25;77(17):1599-604. doi: 10.1212/WNL.0b013e3182343387. Epub 2011 Oct 12.

PMID:
21998314
37.

Serum low-density lipoprotein cholesterol level predicts hematoma growth and clinical outcome after acute intracerebral hemorrhage.

Rodriguez-Luna D, Rubiera M, Ribo M, Coscojuela P, Pagola J, Piñeiro S, Ibarra B, Meler P, Maisterra O, Romero F, Alvarez-Sabin J, Molina CA.

Stroke. 2011 Sep;42(9):2447-52. doi: 10.1161/STROKEAHA.110.609461. Epub 2011 Jul 28.

PMID:
21799167
38.

Condensation prevails over B-A transition in the structure of DNA at low humidity.

Hormeño S, Moreno-Herrero F, Ibarra B, Carrascosa JL, Valpuesta JM, Arias-Gonzalez JR.

Biophys J. 2011 Apr 20;100(8):2006-15. doi: 10.1016/j.bpj.2011.02.049.

39.

Mechanical properties of high-G.C content DNA with a-type base-stacking.

Hormeño S, Ibarra B, Carrascosa JL, Valpuesta JM, Moreno-Herrero F, Arias-Gonzalez JR.

Biophys J. 2011 Apr 20;100(8):1996-2005. doi: 10.1016/j.bpj.2011.02.051.

40.

Bridging intravenous-intra-arterial rescue strategy increases recanalization and the likelihood of a good outcome in nonresponder intravenous tissue plasminogen activator-treated patients: a case-control study.

Rubiera M, Ribo M, Pagola J, Coscojuela P, Rodriguez-Luna D, Maisterra O, Ibarra B, Piñeiro S, Meler P, Romero FJ, Alvarez-Sabin J, Molina CA.

Stroke. 2011 Apr;42(4):993-7. doi: 10.1161/STROKEAHA.110.597104. Epub 2011 Mar 3.

PMID:
21372307
41.

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

Guzmán LF, Perea FJ, Magaña MT, Morales-González KR, Chávez-Velazco ML, Ibarra B.

Hemoglobin. 2010;34(6):509-15. doi: 10.3109/03630269.2010.526483.

PMID:
21077758
42.

Types and frequencies of hemoglobin disorders in the pacific coast of four states of Mexico.

Cobián JG, Sánchez-López JY, Magaña MT, Chávez ML, Perea FJ, Ibarra B.

Rev Invest Clin. 2009 Sep-Oct;61(5):399-404.

PMID:
20184100
43.

Analysis of the SLC4A1 gene in three Mexican patients with hereditary spherocytosis: Report of a novel mutation.

Sánchez-López JY, Camacho-Torres AL, Ibarra B, Tintos JA, Perea FJ.

Genet Mol Biol. 2010 Jan;33(1):9-11. doi: 10.1590/S1415-47572009005000109. Epub 2010 Mar 1.

44.

HB Fannin-Lubbock-I with a single GGC>GAC mutation at beta119(GH2)Gly-->Asp in a homozygous Mexican patient.

Ibarra B, Aizpuru E, Sánchez-López JY, Morales KR, Perea FJ, Ruiz-Reyes G.

Hemoglobin. 2009;33(6):492-7. doi: 10.3109/03630260903332866.

PMID:
19958195
45.

Analysis of linkage disequilibrium between the 5' and 3' haplotypes of the beta-globin gene cluster in Mexican afromestizos.

Magaña MT, Ibarra B, Luévano KE.

Blood Cells Mol Dis. 2010 Mar-Apr;44(2):89-94. doi: 10.1016/j.bcmd.2009.10.004. Epub 2009 Nov 10.

PMID:
19903589
46.

Single centrosome manipulation reveals its electric charge and associated dynamic structure.

Hormeño S, Ibarra B, Chichón FJ, Habermann K, Lange BM, Valpuesta JM, Carrascosa JL, Arias-Gonzalez JR.

Biophys J. 2009 Aug 19;97(4):1022-30. doi: 10.1016/j.bpj.2009.06.004.

47.

Proofreading dynamics of a processive DNA polymerase.

Ibarra B, Chemla YR, Plyasunov S, Smith SB, Lázaro JM, Salas M, Bustamante C.

EMBO J. 2009 Sep 16;28(18):2794-802. doi: 10.1038/emboj.2009.219. Epub 2009 Aug 6.

48.

Diversity of the 5' beta-globin haplotype of four beta-thalassemia mutations in the Mexican population.

Morales KR, Magaña MT, Ibarra B, Perea FJ.

Hemoglobin. 2009;33(1):66-71. doi: 10.1080/03630260802625923.

PMID:
19205976
49.

[Detection of episodes of ischemic tissue hypoxia by means of the combined intraoperative neurophysiologic monitoring with the tissue oxygenation monitoring in aneurysm surgery].

Arikan F, Vilalta J, Minoves T, Moncho D, Vilalta A, Moguer M, Ibarra B, Sahuquillo J.

Neurocirugia (Astur). 2008 Apr;19(2):113-20. Spanish.

PMID:
18500409
50.

Thalidomide therapy in a patient with thalassemia major.

Aguilar-Lopez LB, Delgado-Lamas JL, Rubio-Jurado B, Perea FJ, Ibarra B.

Blood Cells Mol Dis. 2008 Jul-Aug;41(1):136-7. doi: 10.1016/j.bcmd.2008.03.001. Epub 2008 Apr 24. No abstract available.

PMID:
18439858

Supplemental Content

Loading ...
Support Center