Format
Sort by
Items per page

Send to

Choose Destination

Search results

Items: 1 to 20 of 1105

1.
Ann Hematol. 2019 Dec;98(12):2683-2691. doi: 10.1007/s00277-019-03831-7. Epub 2019 Nov 19.

Acute porphyrias: a German monocentric study of the biochemical, molecular genetic, and clinical data of 62 families.

Author information

1
EPNET Clinical Center Munich, Hematology Oncology Center and Ludwig Maximilians University Munich, Zweibrückenstr.2, 80331, Munich, Germany.
2
EPNET Porphyria Specialist Laboratory, MVZ PD Dr. Volkmann, Kriegsstraße 99, 76133, Karlsruhe, Germany.
3
Molecular Genetics Laboratory, MVZ Dr. Eberhard, Brauhausstr.4, 44137, Dortmund, Germany.
4
EPNET Clinical Center Munich, Hematology Oncology Center and Ludwig Maximilians University Munich, Zweibrückenstr.2, 80331, Munich, Germany. petrides@onkologiemuenchen.de.

Abstract

In Germany, analyses of clinical and laboratory features of patients with acute porphyrias are only available for hereditary coproporphyria (HCP) but not with other acute porphyrias, acute intermittent porphyria (AIP) and variegate porphyria (VP). The aim of the study was to analyze a large cohort of patients with particular focus upon quality of life aspects. Sixty-two individuals from separate families with acute porphyrias (57 AIP, 5 VP) were included into an observational study collecting biochemical, genetic, and clinical data. A questionnaire was designed to complete anamnestic information and to assess the influence on quality of life. Most frequent signs and symptoms or laboratory abnormalities were abdominal colicky pain, red coloration of urine, and hyponatremia. Depression or anxiety was reported by 61% or 52% individuals, respectively. Fatigue was mentioned as the most quality of life-limiting symptom. In 59/61 patients, mutations could be identified. 44% (20/45) had to be admitted to an intensive care unit. Heme arginate was used in 64% (29/45) of patients for treatment of acute attacks at least once and in 33% for long-term treatment with high frequency of administration. Serum creatinine values increased in 47% (7/17) of the patients with recurrent attacks. Our analysis confirms a substantial influence of the diseases on the quality of life on patients. Percentages of urine discoloration and intensive care unit admissions were much higher than in other reports. Long-term treatment with heme arginate requires careful monitoring of iron status and renal values.

KEYWORDS:

Acute porphyria; Mutation analysis; Quality of life; Recurrent attacks

PMID:
31745600
DOI:
10.1007/s00277-019-03831-7
[Indexed for MEDLINE]
Icon for Springer
3.
BMC Health Serv Res. 2019 Jul 3;19(1):444. doi: 10.1186/s12913-019-4285-9.

Self-efficacy and self-management strategies in acute intermittent porphyria.

Author information

1
Norwegian Porphyria Centre (NAPOS), Department of Medical Biochemistry and Pharmacology, Haukeland University Hospital, Post Office Box 1400, N-5021, Bergen, Norway. marte.hovik.hammersland@helse-bergen.no.
2
Norwegian Porphyria Centre (NAPOS), Department of Medical Biochemistry and Pharmacology, Haukeland University Hospital, Post Office Box 1400, N-5021, Bergen, Norway.
3
The Norwegian Quality Improvement of Laboratory Examinations (NOKLUS), Haraldsplass Deaconess Hospital, Bergen, Norway.

Abstract

BACKGROUND:

Acute intermittent porphyria (AIP) is an inherited metabolic disease with low clinical penetrance caused by mutations in the hydroxymethylbilane (HMBS) gene. Although most patients experience little or no symptoms, serious attacks may include excruciating pain, severe electrolyte disturbances, paresis, and respiratory failure. Several drugs and lifestyle factors are potential attack inducers and avoiding known triggers is important to avoid symptomatic disease in both patients and genetically predisposed carriers. Our aim in this study was to describe self-efficacy and self-management strategies in self-reported symptomatic and asymptomatic HMBS mutation carriers, and to elucidate motives for predictive genetic testing.

METHODS:

This is a cross-sectional retrospective survey with postal questionnaires. We received responses from 140 HMBS carriers for the general self-efficacy scale (GSES), study-specific questions about symptoms, self-management strategies and motives for genetic testing and satisfaction with the genetic counseling scale (SCS).

RESULTS:

The results indicated high levels of self-efficacy in these Norwegian HMBS mutation carriers. Both self-reported symptomatic and asymptomatic cases recorded changes in behavior after diagnosis, such as avoiding possible triggering drugs and aspiring recommended eating habits. They were in general satisfied with the genetic counseling they had received. The possibility to prevent disease and learn about the risk of their children was their most important motives to undergo genetic testing.

CONCLUSIONS:

This study indicates that continuing to provide information, counseling and education is beneficial in AIP, and that HMBS mutation carriers, both those self-assessed as asymptomatic and as symptomatic, are using their knowledge to avoid triggering factors.

KEYWORDS:

Acute intermittent porphyria; General self-efficacy scale; Genetic counseling; Predictive genetic testing; Satisfaction with genetic counseling scale; Self-efficacy; Self-management strategies

PMID:
31269991
PMCID:
PMC6607542
DOI:
10.1186/s12913-019-4285-9
[Indexed for MEDLINE]
Free PMC Article
Icon for BioMed Central Icon for PubMed Central
4.
Zhonghua Nei Ke Za Zhi. 2019 Jul 1;58(7):520-524. doi: 10.3760/cma.j.issn.0578-1426.2019.07.007.

[Clinical characteristics of 50 patients with acute intermittent porphyria].

[Article in Chinese; Abstract available in Chinese from the publisher]

Author information

1
Department of Gastroenterology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China.
2
Department of Gastrointestinal Surgery, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China.

Abstract

Objective: To analyse the clinical characteristics of patients with acute intermittent porphyria (AIP) in order to improve the understanding and treatment. Methods: Patients diagnosed as AIP and admitted to the First Affiliated Hospital of Zhengzhou University were retrospectively enrolled from January 2008 to July 2018. Data of clinical manifestations, causes, laboratory data, treatment and clinical outcome were recorded. Results: Among the 50 patients, 41 patients (82%) were aged 20 to 40. The ratio of male and female was 1∶1.8. The most common symptoms were abdominal pain (94.0%), nausea, vomiting (72.0%) and constipation (42.0%). Neuropsychiatric disorders were seen in 72.0% patients, and 30.0% of the patients had dark-coloured urine. Precipitating factors included infections, menstruation, starvation, drugs, alcohol consumption, mental stimulation and so on. Laboratory tests were abnormal for urinary porphobilinogen, liver function, hyponatremia, anaemia and so on. Various mutations of hydroxymethylbilane synthase (HMBS) genes were detected in 16 patients. Management strategies included removal of risk factors, administration of glycogen and symptomatic treatment during acute episode. Most patients were discharged with improved conditions. Conclusions: The clinical manifestations of acute intermittent porphyria are complex and diverse. Misdiagnoses or malpractice may be fatal. It is critical to emphasize on its early diagnosis and treatment.

KEYWORDS:

Clinical characteristics; Diagnosis; Porphyria, acute intermittent; Treatment

[Indexed for MEDLINE]
Icon for Chinese Medical Association Publishing House Ltd.
5.
Gastroenterol Clin North Am. 2019 Jun;48(2):183-198. doi: 10.1016/j.gtc.2019.02.001. Epub 2019 Apr 1.

Inborn Errors of Metabolism and the Gastrointestinal Tract.

Author information

1
Admera Health, 126 Corporate Boulevard, South Plainfield, NJ 07080, USA. Electronic address: ruben.b.guerrero@admerahealth.com.
2
Mayo Clinic, 200 First Street Southwest, Rochester, MN 55905, USA.
3
Quest Diagnostics, 33608 Ortega Highway, San Juan Capistrano, CA 92690, USA.

Abstract

Inborn errors of metabolism (IEMs) are usually recognized by characteristic neurologic and metabolic manifestations and sometimes by dysmorphism. However, IEMs can present with a wide variety of gastrointestinal manifestations, whether as the primary or a minor clinical symptom. Regardless, gastrointestinal and hepatic manifestations of IEMs are important clinical features that can help identify an underlying defect; these disorders should be taken into consideration as part of a patient's clinical assessment. It is prudent to include metabolic disorders in the differential diagnosis because in some cases, gastrointestinal symptoms may be the only presenting feature in a patient with an underlying IEM.

KEYWORDS:

Disorder; Error; Gastrointestinal; Hepatic; Inborn; Manifestations; Metabolism

PMID:
31046970
DOI:
10.1016/j.gtc.2019.02.001
[Indexed for MEDLINE]
Icon for Elsevier Science
6.
Neurol Sci. 2019 Apr;40(4):661-669. doi: 10.1007/s10072-019-03778-7. Epub 2019 Mar 1.

Genetic neuromuscular disorders: living the era of a therapeutic revolution. Part 1: peripheral neuropathies.

Author information

1
Unit of Neurology and Neuromuscular Diseases, Department of Clinical and Experimental Medicine, University of Messina, Messina, Italy. vitag@unime.it.
2
Nemo Sud Clinical Centre for Neuromuscular Disorders, Messina, Italy. vitag@unime.it.
3
Nemo Sud Clinical Centre for Neuromuscular Disorders, Messina, Italy.
4
Unit of Neurology and Neuromuscular Diseases, Department of Clinical and Experimental Medicine, University of Messina, Messina, Italy.

Abstract

Recent advances in pathophysiological and genetic mechanisms of some neuromuscular diseases and a rapid progress in new pharmacological technologies led to an accelerated development of innovative treatments, generating an unexpected therapeutic revolution. In part 1, we report already commercially available drugs, just approved drugs and new therapeutic promises in the treatment of peripheral neuropathies. Hereditary transthyretin amyloidosis (hATTR) is a devastating disease due to amyloid accumulation in peripheral nerves, heart and autonomic system. The first specific drug approved for hATTR was tafamidis, a TTR tetramer stabilizer. In 2018, the positive results of two phase 3 trials have been reported leading to start of regulatory approval route for inotersen, an antisense oligonucleotide and patisiran, the first-ever RNA interference (RNAi) therapeutic. System biology targeting approach has indicated baclofen, naltrexone and sorbitol in combination (PXT3003) as candidate drugs for Charcot-Marie-Tooth disease type 1A. This hypothesis was confirmed in experimental models and in phase 2 and 3 clinical trials. Givosiran, another RNAi therapeutic, targeting 5-aminolevulinic acid synthase, has been positively tested in acute intermittent porphyria in phase 1/2 and ongoing phase 3 trials. Although allogenic hematopoietic stem cell transplantation resulted recently a long-term therapy in mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), a new strategy is liver transplantation which is able to revert the severe biochemical and clinical imbalance of the disease. Recently, a gene therapy has been tested in a MNGIE murine model, indicating that it may become a new therapeutic option.

KEYWORDS:

Acute intermittent porphyria; Charcot–Marie–Tooth disease; Hereditary transthyretin amyloidosis; Inotersen; Mitochondrial neurogastrointestinal encephalomyopathy; Patisiran

PMID:
30847674
DOI:
10.1007/s10072-019-03778-7
[Indexed for MEDLINE]
Icon for Springer
7.
Orphanet J Rare Dis. 2019 Feb 26;14(1):59. doi: 10.1186/s13023-019-1031-7.

High penetrance of acute intermittent porphyria in a Spanish founder mutation population and CYP2D6 genotype as a susceptibility factor.

Author information

1
Cátedra de Genética (Pabellón 9), Facultad de Ciencias de la Salud, Universidad Católica de Murcia (UCAM), Avda. Los Jerónimos s/n, CP 30107, Guadalupe, Murcia, Spain. mbarreda@ucam.edu.
2
Servicio de Neurología, Hospital Comarcal del Noroeste, Caravaca, Murcia, Spain.
3
Centro de Bioquímica y Genética Clínica, Hospital Clínico Universitario Virgen de la Arrixaca, IMIB- Arrixaca, Murcia, Spain.
4
CIBERER-ISCIII, Madrid, Spain.
5
Grupo Applied Statistical Methods in Medical Research, Universidad Católica de Murcia (UCAM), Murcia, Spain.
6
Cátedra de Genética (Pabellón 9), Facultad de Ciencias de la Salud, Universidad Católica de Murcia (UCAM), Avda. Los Jerónimos s/n, CP 30107, Guadalupe, Murcia, Spain.
7
Sección Genética Médica (Pabellón Materno-Infantil), Servicio de Pediatría, Hospital Clínico Universitario Virgen de la Arrixaca, IMIB-Arrixaca, Ctra. Madrid-Cartagena s/n, CP 30120, El Palmar, Murcia, Spain.
8
Sección Genética Médica, Servicio de Pediatría, Hospital Clínico Universitario Virgen de la Arrixaca, Universidad de Murcia, IMIB-Arrixaca, Murcia, Spain.
9
Sección Genética Médica, Servicio de Pediatría, Hospital Clínico Universitario Virgen de la Arrixaca, Murcia, Spain.
10
Centro de Bioquímica y Genética Clínica, Hospital Clínico Universitario Virgen de la Arrixaca, IMIB-Arrixaca, Murcia, Spain.
11
CIBERER-ISCIII, Madrid, Spain. encarna.guillen@carm.es.
12
Sección Genética Médica (Pabellón Materno-Infantil), Servicio de Pediatría, Hospital Clínico Universitario Virgen de la Arrixaca, IMIB-Arrixaca, Ctra. Madrid-Cartagena s/n, CP 30120, El Palmar, Murcia, Spain. encarna.guillen@carm.es.
13
Departamento de Cirugía, Pediatría, Obstetricia y Ginecología, Facultad de Medicina, Universidad de Murcia, Murcia, Spain. encarna.guillen@carm.es.

Abstract

BACKGROUND:

Acute intermittent porphyria (AIP) is a low-penetrant genetic metabolic disease caused by a deficiency of hydroxymethylbilane synthase (HMBS) in the haem biosynthesis. Manifest AIP (MAIP) is considered when carriers develop typical acute neurovisceral attacks with elevation of porphyrin precursors, while the absence of attacks is referred to as latent AIP (LAIP). Attacks are often triggered by drugs, endocrine factors, fasting or stress. Although AIP penetrance is traditionally considered to be around 10-20%, it has been estimated to be below 1% in general population studies and a higher figure has been found in specific AIP populations. Genetic susceptibility factors underlying penetrance are still unknown. Drug-metabolizing cytochrome P450 enzymes (CYP) are polymorphic haem-dependent proteins which play a role in haem demand, so they might modulate the occurrence of AIP attacks. Our aim was to determine the prevalence and penetrance of AIP in our population and analyse the main hepatic CYP genes to assess their association with acute attacks. For this, CYP2C9*2, *3; CYP2C19*2; CYP2D6*4, *5; CYP3A4*1B and CYP3A5*3 defective alleles were genotyped in fifty AIP carriers from the Region of Murcia, a Spanish population with a high frequency of the HMBS founder mutation c.669_698del30.

RESULTS:

AIP penetrance was 52%, and prevalence was estimated as 17.7 cases/million inhabitants. The frequency of defective CYP2D6 alleles was 3.5 times higher in LAIP than in MAIP. MAIP was less frequent among CYP2D6*4 and *5 carriers (p < 0.05). The urine porphobilinogen (PBG)-to-creatinine ratio was lower in these individuals, although it was associated with a lower prevalence of attacks (p < 0.05) rather than with the CYP2D6 genotype.

CONCLUSIONS:

AIP prevalence in our region is almost 3 times higher than that estimated for the rest of Spain. The penetrance was high, and similar to other founder mutation AIP populations. This is very relevant for genetic counselling and effective health care. CYP2D6*4 and *5 alleles may be protective factors for acute attacks, and CYP2D6 may constitute a penetrance-modifying gene. Further studies are needed to confirm these findings, which would allow a further progress in clinical risk profile assessment based on the CYP genotype, leading to predictive personalized medicine for each AIP carrier in the future.

KEYWORDS:

Acute attacks; Acute intermittent porphyria; CYP2D6; Founder mutation; Genomic medicine; Penetrance; Personalized medicine; Susceptibility factor

PMID:
30808393
PMCID:
PMC6390611
DOI:
10.1186/s13023-019-1031-7
[Indexed for MEDLINE]
Free PMC Article
Icon for BioMed Central Icon for PubMed Central
8.
Gut. 2019 Jul;68(7):1323-1330. doi: 10.1136/gutjnl-2019-318269. Epub 2019 Feb 22.

Messenger RNA therapy for rare genetic metabolic diseases.

Author information

1
Immunology and Immunotherapy Program, Centro de Investigación Médica Aplicada (Cima), University of Navarra, Pamplona, Navarra, Spain.
2
Centro de Investigación Biomédica en Red de Cáncer, CIBERonc, Instituto de Salud Carlos III, Madrid, Spain.
3
Instituto de Investigación Sanitaria de Navarra IdiSNA, Pamplona, Spain.
4
Moderna Therapeutics, Cambridge, Massachusetts, USA.
5
Hepatology Program, CIMA, University of Navarra, Pamplona, Navarra, Spain.
6
Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas, CIBERehd, Instituto de Salud Carlos III, Madrid, Spain.

Abstract

Decades of intense research in molecular biology and biochemistry are fructifying in the emergence of therapeutic messenger RNAs (mRNA) as a new class of drugs. Synthetic mRNAs can be sequence optimised to improve translatability into proteins, as well as chemically modified to reduce immunogenicity and increase chemical stability using naturally occurring uridine modifications. These structural improvements, together with the development of safe and efficient vehicles that preserve mRNA integrity in circulation and allow targeted intracellular delivery, have paved the way for mRNA-based therapeutics. Indeed, mRNAs formulated into biodegradable lipid nanoparticles are currently being tested in preclinical and clinical studies for multiple diseases including cancer immunotherapy and vaccination for infectious diseases. An emerging application of mRNAs is the supplementation of proteins that are not expressed or are not functional in a regulated and tissue-specific manner. This so-called 'protein replacement therapy' could represent a solution for genetic metabolic diseases currently lacking effective treatments. Here we summarise this new class of drugs and discuss the preclinical evidence supporting the potential of liver-mediated mRNA therapy for three rare genetic conditions: methylmalonic acidaemia, acute intermittent porphyria and ornithine transcarbamylase deficiency.

KEYWORDS:

genetics; liver metabolism; molecular biology

PMID:
30796097
DOI:
10.1136/gutjnl-2019-318269
[Indexed for MEDLINE]
Icon for HighWire

Conflict of interest statement

Competing interests: PGVM is an employee of Moderna, focusing on the development of therapeutic approaches for rare diseases. PGVM receives a salary and stock options from Moderna, as compensation for his employment by the company.

9.
Zh Nevrol Psikhiatr Im S S Korsakova. 2019;119(1):72-75. doi: 10.17116/jnevro201911901172.

[A rare case of neurological manifestations of acute intermittent porphyria].

[Article in Russian; Abstract available in Russian from the publisher]

Author information

1
Vagner Perm State Medical University, Perm, Russia.
2
Perm Regional clinical Hospital, Perm, Russia.

Abstract

The authors describe a rare and diagnostically difficult variant of neurological symptoms of acute intermittent porphyria complicated by rhabdomyolysis. Diagnostic criteria of the disease are highlighted. A differential diagnosis with diseases with similar clinical manifestation was made.

KEYWORDS:

acute intermittent porphyria; neurological complications; rhabdomyolysis; δ-aminolevulinic acid

PMID:
30778035
DOI:
10.17116/jnevro201911901172
[Indexed for MEDLINE]
10.
N Engl J Med. 2019 Feb 7;380(6):549-558. doi: 10.1056/NEJMoa1807838.

Phase 1 Trial of an RNA Interference Therapy for Acute Intermittent Porphyria.

Author information

1
From the Porphyria Centre Sweden, Karolinska Institutet, Karolinska University Hospital, Stockholm (E.S., P.H., D.V.); Icahn School of Medicine at Mount Sinai, New York (M.B., R.D.); King's College Hospital, London (P.S., D.R.); University of California, San Francisco, San Francisco (D.M.B.); University of Utah, Salt Lake City (C. Parker, J.P.); Wake Forest University, Winston-Salem, NC (H.L.B.); Alnylam Pharmaceuticals, Cambridge, MA (C. Penz, A.C.-D., Q.H., W.Q., K.F., J.B.K., P.G., A.V., A.R.S.); and the University of Texas Medical Branch at Galveston, Galveston (K.E.A.).

Abstract

BACKGROUND:

Induction of delta aminolevulinic acid synthase 1 ( ALAS1) gene expression and accumulation of neurotoxic intermediates result in neurovisceral attacks and disease manifestations in patients with acute intermittent porphyria, a rare inherited disease of heme biosynthesis. Givosiran is an investigational RNA interference therapeutic agent that inhibits hepatic ALAS1 synthesis.

METHODS:

We conducted a phase 1 trial of givosiran in patients with acute intermittent porphyria. In part A of the trial, patients without recent porphyria attacks (i.e., no attacks in the 6 months before baseline) were randomly assigned to receive a single subcutaneous injection of one of five ascending doses of givosiran (0.035, 0.10, 0.35, 1.0, or 2.5 mg per kilogram of body weight) or placebo. In part B, patients without recent attacks were randomly assigned to receive once-monthly injections of one of two doses of givosiran (0.35 or 1.0 mg per kilogram) or placebo (total of two injections 28 days apart). In part C, patients who had recurrent attacks were randomly assigned to receive injections of one of two doses of givosiran (2.5 or 5.0 mg per kilogram) or placebo once monthly (total of four injections) or once quarterly (total of two injections) during a 12-week period, starting on day 0. Safety, pharmacokinetic, pharmacodynamic, and exploratory efficacy outcomes were evaluated.

RESULTS:

A total of 23 patients in parts A and B and 17 patients in part C underwent randomization. Common adverse events included nasopharyngitis, abdominal pain, and diarrhea. Serious adverse events occurred in 6 patients who received givosiran in parts A through C combined. In part C, all 6 patients who were assigned to receive once-monthly injections of givosiran had sustained reductions in ALAS1 messenger RNA (mRNA), delta aminolevulinic acid, and porphobilinogen levels to near normal. These reductions were associated with a 79% lower mean annualized attack rate than that observed with placebo (exploratory efficacy end point).

CONCLUSIONS:

Once-monthly injections of givosiran in patients who had recurrent porphyria attacks resulted in mainly low-grade adverse events, reductions in induced ALAS1 mRNA levels, nearly normalized levels of the neurotoxic intermediates delta aminolevulinic acid and porphobilinogen, and a lower attack rate than that observed with placebo. (Funded by Alnylam Pharmaceuticals; ClinicalTrials.gov number, NCT02452372 .).

PMID:
30726693
DOI:
10.1056/NEJMoa1807838
[Indexed for MEDLINE]
Icon for Atypon
11.
Transplant Proc. 2019 Jan - Feb;51(1):229-234. doi: 10.1016/j.transproceed.2018.02.213. Epub 2018 Jun 30.

Rhodococcus equi Pneumonia in Kidney Transplant Recipient Affected by Acute Intermittent Porphyria: A Case Report.

Author information

1
Surgical, Medical and Dental Department of Morphological Sciences, Section of Nephrology, University of Modena and Reggio Emilia, Modena, Italy. Electronic address: gaetano.alfano@unimore.it.
2
Center for Porphyrias, Internal Medicine 2 Unit, Department of Medical and Surgical Science for Children and Adults, University of Modena and Reggio Emilia.
3
Surgical, Medical and Dental Department of Morphological Sciences, Section of Nephrology, University of Modena and Reggio Emilia, Modena, Italy.
4
Infectious Diseases Clinic University of Modena and Reggio Emilia School of Medicine, Department of Medicine and Medical specialities, AOU Policlinico of Modena, Modena, Italy.

Abstract

Rhodococcus equi is a gram-positive coccobacillus responsible for severe infections in patients with weakened immune systems. R equi generally causes pnumonia that may evolve into fatal systemic infection if left untreated. Here, we present a case of a 67-year-old woman affected by acute intermittent porphyria (AIP) who developed R equi pneumonia 7 months after kidney transplantation. Although clinical features at presentation were nonspecific, lung computed tomography showed right perihilar consolidation with a mass-like appearance causing bronchial obstruction. Appropriate antibiotic including intravenous meropenem and oral azithromycin that was then switched to oral levofloxacin and oral azithromycin along with reduction of immunosuppressive therapy resolved pneumonia without provoking an acute attack of porphyria. AIP limited the choice of antibiotics for the treatment of R equi infection because some potentially porphyrinogenic antibacterial agents were avoided. Based on this experience, azithromycin and meropenem can be safely administered for the treatment of R Equi infection in patients with AIP.

[Indexed for MEDLINE]
Icon for Elsevier Science
12.
PLoS One. 2018 Dec 20;13(12):e0208753. doi: 10.1371/journal.pone.0208753. eCollection 2018.

Investigating epigenetic effects of activation-induced deaminase in chronic lymphocytic leukemia.

Author information

1
Department of Internal Medicine III with Haematology, Medical Oncology, Haemostaseology, Infectiology and Rheumatology, Oncologic Center, Salzburg Cancer Research Institute-Laboratory for Immunological and Molecular Cancer Research (SCRI-LIMCR), Paracelsus Medical University, Salzburg, Austria, Cancer Cluster Salzburg, Salzburg, Austria.
2
Biocenter, Division of Bioinformatics, Medical University of Innsbruck, Innsbruck, Austria.

Abstract

Activation induced deaminase (AID) has two distinct and well defined roles, both relying on its deoxycytidine (dC) deaminating function: one as a DNA mutator and another in DNA demethylation. In chronic lymphocytic leukemia (CLL), AID was previously shown to be an independent negative prognostic factor. While there is substantial impact on DNA mutations, effects of AID on gene expression by promoter demethylation of disease related target genes in leukemia has not been addressed. To shed light on this question, we aimed at determining genome wide methylation changes as well as gene expression changes in response to AID expression in CLL. Although we found minor differences in individual methylation variable positions following AID expression, we could not find recurrent methylation changes of specific target sites or changes in global methylation.

PMID:
30571766
PMCID:
PMC6301619
DOI:
10.1371/journal.pone.0208753
[Indexed for MEDLINE]
Free PMC Article
Icon for Public Library of Science Icon for PubMed Central
13.
Trends Mol Med. 2019 Jan;25(1):3-5. doi: 10.1016/j.molmed.2018.11.003. Epub 2018 Dec 6.

Systemic Administered mRNA as Therapy for Metabolic Diseases.

Author information

1
UMRs 1149, Centre de Recherche sur l'Inflammation, Institut National de la Santé et de la Recherche Médicale, Université Paris Diderot, F-75018 Paris, France; Assistance Publique-Hôpitaux de Paris, HUPNVS Centre Français des Porphyries, Hôpital Louis Mourier, 178 Rue des Renouillers, F-92701 Colombes, France; Laboratory of Excellence Gr-Ex, 75015 Paris, France. Electronic address: herve.puy@aphp.fr.
2
UMRs 1149, Centre de Recherche sur l'Inflammation, Institut National de la Santé et de la Recherche Médicale, Université Paris Diderot, F-75018 Paris, France; Assistance Publique-Hôpitaux de Paris, HUPNVS Centre Français des Porphyries, Hôpital Louis Mourier, 178 Rue des Renouillers, F-92701 Colombes, France; Laboratory of Excellence Gr-Ex, 75015 Paris, France. Electronic address: jc.deybach@me.com.
3
UMRs 1149, Centre de Recherche sur l'Inflammation, Institut National de la Santé et de la Recherche Médicale, Université Paris Diderot, F-75018 Paris, France; Assistance Publique-Hôpitaux de Paris, HUPNVS Centre Français des Porphyries, Hôpital Louis Mourier, 178 Rue des Renouillers, F-92701 Colombes, France; Laboratory of Excellence Gr-Ex, 75015 Paris, France. Electronic address: laurent.gouya@inserm.fr.

Abstract

The potential of mRNA to produce therapeutic and protective protein levels is a promising approach for the treatment of a large number of diseases. In a recent study published in Nature Medicine (Published online October 8, 2018. doi.org/10.1038/s41591-018-0199-z), the intravenous delivery of human porphobilinogen deaminase (PBGD) mRNA, targeting the liver, demonstrated its efficacy and safety to replace the defective PBGD protein in preclinical models of acute intermittent porphyria.

KEYWORDS:

RNA; acute intermittent porphyria; liver; metabolic disorder; nanoparticles

PMID:
30528119
DOI:
10.1016/j.molmed.2018.11.003
[Indexed for MEDLINE]
Icon for Elsevier Science
14.
Internist (Berl). 2018 Dec;59(12):1239-1248. doi: 10.1007/s00108-018-0509-z.

[Porphyrias-what is verified?]

[Article in German]

Author information

1
Klinik für Innere Medizin II, Gastroenterologie, Hepatologie, Diabetologie, Infektiologie, Onkologie, Intensivmedizin, Klinikum Chemnitz gGmbH, 09009, Chemnitz, Deutschland. u.stoelzel@skc.de.
2
Klinik für Innere Medizin II, Gastroenterologie, Hepatologie, Diabetologie, Infektiologie, Onkologie, Intensivmedizin, Klinikum Chemnitz gGmbH, 09009, Chemnitz, Deutschland.
3
MVZ Labor PD Dr. Volkmann und Kollegen GbR, 76133, Karlsruhe, Deutschland.

Abstract

Porphyrias are caused by enzyme defects of heme biosynthesis. According to their clinical presentation and to each affected pathway, they are categorized into acute and non-acute as well as hepatic and erythropoietic porphyrias. Acute hepatic porphyrias, e.g. acute intermittent porphyria (AIP), porphyria variegata (VP), hereditary coproporphyria (HCP) and 5‑aminolevulinic acid dehydratase-deficient porphyria (ALADP) are characterized by accumulation of the porphyrin precursors 5‑aminolevulinic acid (ALA) and porphobilinogen (PBG) that correlate with severe abdominal, psychiatric, neurological or cardiovascular symptoms. Additionally, skin photosensitivity can occur in VP and less frequently, in HCP. Decisive for the diagnosis of acute hepatic porphyrias are a >4-fold elevated urinary excretion of ALA in ALADP and ALA and PBG in all other acute porphyrias. First-line treatment of an acute porphyria attack includes intensive care with pain management, sufficient caloric supply, strict avoidance of porphyrinogenic drugs and elimination of other triggering factors. Heme therapy is indispensable in case of developing neurological symptoms and clinical worsening despite first-line measures. Non-acute porphyrias, mainly porphyria cutanea tarda (PCT), erythropoietic protoporphyria (EPP) and X‑linked protoporphyria (XLP) display accumulation of porphyrins in the skin and/or liver resulting in photosensitivity up to possible liver damage. Patients with PCT benefit from iron depletion, low-dose chloroquine treatment and/or hepatitis C virus elimination. Afamelanotide is associated with better sunlight tolerance in patients with EPP and XLP. Moreover, innovative therapies that highly selectively address dysregulated steps of the heme biosynthetic pathway are currently under clinical trial.

KEYWORDS:

Aminolevulinic acid; Heme synthesis; Hepatitis C; Iron; RNA interference

PMID:
30328490
DOI:
10.1007/s00108-018-0509-z
[Indexed for MEDLINE]
Icon for Springer
15.
A A Pract. 2019 Apr 15;12(8):288-291. doi: 10.1213/XAA.0000000000000912.

Porphyria Attack Manifesting as Delayed Emergence and Precipitated by Prolonged Cardiopulmonary Bypass: A Case Report of 2 Novel Observations.

Author information

1
From the Departments of Anesthesiology.
2
Critical Care, Mayo Clinic, Jacksonville, Florida.

Abstract

Acute porphyria is a group of rare disorders in the biosynthesis pathway of heme that can result in severe neurovisceral attacks leading to morbidity and mortality. Perioperative complications have been largely prevented due to avoidance of precipitants and early treatment of symptoms. However, these measures may not always be successful, because not all physiological stressors can be evaded. This case illustrates a porphyria attack precipitated by prolonged cardiopulmonary bypass that manifested as postoperative delayed emergence, failure to wean from mechanical ventilation, autonomic insufficiency requiring significant vasoactive agents, and, ultimately, failure to thrive. The patient passed after withdrawal of care.

PMID:
30312175
DOI:
10.1213/XAA.0000000000000912
[Indexed for MEDLINE]
Icon for Wolters Kluwer
16.
Nat Med. 2018 Dec;24(12):1899-1909. doi: 10.1038/s41591-018-0199-z. Epub 2018 Oct 8.

Systemic messenger RNA as an etiological treatment for acute intermittent porphyria.

Author information

1
Moderna Therapeutics, Cambridge, MA, USA.
2
Program of Immunology and Immunotherapy, Centre for Applied Medical Research (CIMA), University of Navarra, Pamplona, Spain.
3
Instituto de Investigación Sanitaria de Navarra (IdiSNA), Pamplona, Spain.
4
Centro de Investigación Biomédica en Red de Cáncer (CIBERONC), Instituto de Salud Carlos III, Madrid, Spain.
5
Hepatology Program, Centre for Applied Medical Research (CIMA), University of Navarra, Pamplona, Spain.
6
Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Instituto de Salud Carlos III, Madrid, Spain.
7
Department of Clinical Neurophysiology, Clínica Universitaria, University of Navarra, Pamplona, Spain.
8
Neurophysiology Laboratory, Neuroscience Program, Centre for Applied Medical Research (CIMA), University of Navarra, Pamplona, Spain.
9
Department of Biochemistry and Genetics, University of Navarra, Pamplona, Spain.
10
Moderna Therapeutics, Cambridge, MA, USA. paolo.martini@modernatx.com.
11
Instituto de Investigación Sanitaria de Navarra (IdiSNA), Pamplona, Spain. afontanellas@unav.es.
12
Hepatology Program, Centre for Applied Medical Research (CIMA), University of Navarra, Pamplona, Spain. afontanellas@unav.es.
13
Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Instituto de Salud Carlos III, Madrid, Spain. afontanellas@unav.es.

Abstract

Acute intermittent porphyria (AIP) results from haploinsufficiency of porphobilinogen deaminase (PBGD), the third enzyme in the heme biosynthesis pathway. Patients with AIP have neurovisceral attacks associated with increased hepatic heme demand. Phenobarbital-challenged mice with AIP recapitulate the biochemical and clinical characteristics of patients with AIP, including hepatic overproduction of the potentially neurotoxic porphyrin precursors. Here we show that intravenous administration of human PBGD (hPBGD) mRNA (encoded by the gene HMBS) encapsulated in lipid nanoparticles induces dose-dependent protein expression in mouse hepatocytes, rapidly normalizing urine porphyrin precursor excretion in ongoing attacks. Furthermore, hPBGD mRNA protected against mitochondrial dysfunction, hypertension, pain and motor impairment. Repeat dosing in AIP mice showed sustained efficacy and therapeutic improvement without evidence of hepatotoxicity. Finally, multiple administrations to nonhuman primates confirmed safety and translatability. These data provide proof-of-concept for systemic hPBGD mRNA as a potential therapy for AIP.

PMID:
30297912
DOI:
10.1038/s41591-018-0199-z
[Indexed for MEDLINE]
Icon for Nature Publishing Group
17.
Medicine (Baltimore). 2018 Sep;97(37):e12295. doi: 10.1097/MD.0000000000012295.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

Author information

1
Shanxi Medical University.
2
Department of Endocrinology, The First Hospital of Shanxi Medical University, Taiyuan, China.
3
Epidemiology Department, University of California Los Angeles, CA, USA.

Abstract

RATIONALE:

Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation.

PATIENT CONCERNS:

A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia.

DIAGNOSES:

She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome.

INTERVENTIONS:

The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing.

OUTCOMES:

A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability.

LESSONS:

Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

PMID:
30212967
PMCID:
PMC6156069
DOI:
10.1097/MD.0000000000012295
[Indexed for MEDLINE]
Free PMC Article
Icon for Wolters Kluwer Icon for PubMed Central
18.
Mol Genet Metab. 2018 Nov;125(3):295-301. doi: 10.1016/j.ymgme.2018.09.002. Epub 2018 Sep 5.

Molecular characterization, by digital PCR analysis of four HMBS gene mutations affecting the ubiquitous isoform of Porphobilinogen Deaminase (PBGD) in patients with Acute Intermittent Porphyria (AIP).

Author information

1
Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, U.O.C. Medicina Generale, Milano, Italy.
2
Instituto de Investigación, Hospital 12 de Octubre, Madrid, Spain.
3
Division of Internal Medicine 2 - Centre for Porphyrias, Dept. of Medical and Surgical Sciences for Children and Adults, University of Modena and Reggio Emilia, Policlinico Hospital, Modena, Italy.
4
Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, U.O.C. Medicina Generale, Milano, Italy. Electronic address: elena.dipierro@policlinico.mi.it.

Abstract

Genetic variants in promoters and alternative-splicing lesions require to be experimentally tested in order to validate them as causatives of a disease. The digital PCR (dPCR) approach, which is an alternative to the classical qPCR, is an innovative and a more sensitive method for the detection and quantification of nucleic acids. In the present study, we identified four HMBS gene mutations affecting the ubiquitous isoform of porphobilinogen deaminase (PBGD) and established a dPCR protocol which would be able to detect the different transcripts of this gene. With the application of this method, we were able to characterize the functional roles of these four genetic variants, demonstrating that all these mutations were causatives of the non-erythroid variant of the acute intermittent porphyria (AIP) disease.

KEYWORDS:

Digital PCR; Gene expression; HMBS; Porphyria; Promoter variants; Splicing isoform

PMID:
30201327
DOI:
10.1016/j.ymgme.2018.09.002
[Indexed for MEDLINE]
Icon for Elsevier Science
19.
Medicine (Baltimore). 2018 Sep;97(36):e11665. doi: 10.1097/MD.0000000000011665.

Acute intermittent porphyria presenting with seizures and posterior reversible encephalopathy syndrome: Two case reports and a literature review.

Author information

1
Neurology Department.
2
Geriatric Department.
3
Radiology Department, The Affiliated Hospital of Qingdao University, Qingdao.
4
Radiology Department, Central Hospital of Laiyang, Yantai.
5
Urology Department, Qilu Hospital of Shandong University, Qingdao, Shandong Province, China.

Abstract

INTRODUCTION:

Acute intermittent porphyria (AIP) is a rare and challenging hereditary neurovisceral disease with no specific symptoms. Posterior reversible encephalopathy syndrome (PRES) is a clinicoradiological syndrome with bilateral reversible posterior gyriform lesions that can be associated with many different conditions, including AIP. Usually, peripheral neuropathy is considered the most common neurological manifestation of AIP. However, AIP should also be considered when seizures and PRES are associated with unexplained abdominal pain.

CASE PRESENTATION:

Both the patients were presented with seizures and PRES on brain magnetic resonance imaging (MRI). Unexplained abdominal pain occurred before the onset of seizures. The AIP diagnosis was made after repeated Watson-Schwartz tests. Hematin was not available for these 2 patients. However, supportive treatment including adequate nutrition and fluid therapy as well as specific antiepileptic drugs aided the patient's recovery and no acute attacks had occurred by the 3-year follow-up.

CONCLUSION:

In contrast to other causes of PRES patients, seizure is the most common symptom in AIP patients with PRES. This is a strong diagnostic clue for AIP when ambiguous abdominal pain patients presented with seizures and PRES on brain MRI. A positive prognosis can be achieved with the combination of early recognition, supportive and intravenous hematin therapy, and withdrawal of precipitating factors, including some antiepileptic drugs.

PMID:
30200061
PMCID:
PMC6133578
DOI:
10.1097/MD.0000000000011665
[Indexed for MEDLINE]
Free PMC Article
Icon for Wolters Kluwer Icon for PubMed Central
20.
Hum Mol Genet. 2018 Nov 1;27(21):3688-3696. doi: 10.1093/hmg/ddy283.

Bioengineered PBGD variant improves the therapeutic index of gene therapy vectors for acute intermittent porphyria.

Author information

1
Hepatology Program, CIMA-University of Navarra, Spain.
2
Navarra Institute for Health Research (IDISNA), Pamplona, Spain.
3
Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barcelona, Cerdanyola del Vallès 08193 Spain.
4
Research Center, Hospital Universitario 12 de Octubre, UCM, Madrid, Spain.
5
Protein Stability and Inherited Disease Laboratory, CIC bioGUNE, Derio, Spain.
6
Proteomics Unit, Centro Nacional de Biotecnología (CSIC), Madrid, Spain.
7
Program of Immunology and Immunotherapy, CIMA-University of Navarra, Pamplona, Spain.
8
Centro de Investigación Biomédica en Red de Cáncer (CIBERONC), Spain.
9
Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Instituto de Salud Carlos III, Spain.

Abstract

A first-in-human gene therapy trial using a recombinant adeno-associated viral (rAAV) vector for acute intermittent porphyria (AIP) reveals that higher doses would be required to reach therapeutic levels of the porphobilinogen deaminase (PBGD) transgene. We developed a hyperfunctional PBGD protein to improve the therapeutic index without increasing vector dose. A consensus protein sequence from 12 mammal species was compared to the human PBGD sequence, and eight amino acids were selected. I291M and N340S variants showed the highest increase in enzymatic activity when expressed in prokaryotic and eukaryotic systems. In silico analysis indicates that isoleucine 291 to methionine and asparagine 340 to serine variants did not affect the active site of the enzyme. In vitro analysis indicated a synergistic interaction between these two substitutions that improve kinetic stability. Finally, full protection against a phenobarbital-induced attack was achieved in AIP mice after the administration of 1 × 1011 gc/kg of rAAV2/8-PBGD-I291M/N340S vector; three times lower than the dose required to achieve full protection with the control rAAV2/8-hPBGD vector. In conclusion, we have developed and characterized a hyperfunctional PBGD protein. The inclusion of this variant sequence in a rAAV2/8 vector allows the effective dose to be lowered in AIP mice.

PMID:
30085095
DOI:
10.1093/hmg/ddy283
[Indexed for MEDLINE]
Icon for Silverchair Information Systems

Supplemental Content

Loading ...
Support Center