Format

Send to

Choose Destination
Mol Gen Genet. 1997 Aug;255(5):487-94.

Functional analysis of the recA promoter of Rhodobacter capsulatus.

Author information

1
Department of Genetics and Microbiology, Universitat Autónoma of Barcelona, Bellaterra, Spain.

Abstract

Expression of the Rhodobacter capsulatus recA gene is inducible by DNA damage. By using primer extension and serial deletion, we have identified the promoter of the R. capsulatus recA gene. Electrophoretic mobility-shift assays experiments have shown that a protein binds to a region of the R. capsulatus recA promoter containing the imperfect palindromic TTGTACTCATACCATGAGAACAA, which is centered on position-8 with respect to the transcriptional starting site. PCR mutagenesis of both halves of this palindrome indicates that the TTGT and ACAA motifs are necessary both for normal DNA-protein complex formation in vitro and for full DNA damage-mediated induction of recA. Nevertheless, the basal level of recA expression is not increased when both halves of the TTGTN15ACAA sequence are mutagenized. These data suggest that the R. capsulatus recA gene may be regulated by a positive transcription factor which binds to this palindrome.

PMID:
9294033
DOI:
10.1007/s004380050521
[Indexed for MEDLINE]

Supplemental Content

Loading ...
Support Center