
Send to

Choose Destination
Biochemistry. 1996 Dec 17;35(50):16361-9.

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

Author information

Department of Biochemistry, Biophysics, and Macromolecular Chemistry, University of Trieste, Italy.


The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

[Indexed for MEDLINE]

Supplemental Content

Full text links

Icon for American Chemical Society
Loading ...
Support Center