Format

Send to

Choose Destination
Gene. 1995 May 26;158(1):83-6.

Cloning and sequencing of a beta-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis.

Author information

1
Department of Microbiology, Stockholm University, Sweden.

Abstract

A beta-lactamase (Bla)-encoding gene (bla) from Bacillus thuringiensis (Bt) was cloned and the nucleotide (nt) sequence was determined. Both the nt sequence and deduced amino acid sequences reveal that the Bt Bla is very similar to that of B. cereus and other group A Bla. The transcription start point was also determined. Comparison of the upstream region of Bt bla with that of other genes suggested the presence of three sequence elements that might be involved in promoter function: the -10 (TCGGTGAT) and -35 (TTAT) sequences, an A+T-rich region (5'TACTAGCTATAATTTTTTAGT) and an inverted repeat sequence (5'-GAGATAGAGGC[GCTACTATCTC).

PMID:
7789815
DOI:
10.1016/0378-1119(95)00089-o
[Indexed for MEDLINE]

Supplemental Content

Full text links

Icon for Elsevier Science
Loading ...
Support Center