The placenta is exposed to metabolites and hormones of mother and fetus. Diabetes (T1D and GDM)-associated changes in levels of insulin, IGF1, IGF2, IGFBP1, IGFBP3 in maternal and fetal blood and in the placenta may influence placental function. Higher (↑), lower (↓) or similar (=) levels in T1D (¹) or GDM (²) compared to normal pregnancies are indicated and taken from available references (; ; ; ; ; ; ; ; ; , ; ; ; ). Factors are printed in bold if the regulation in T1D and GDM is similar.

The spatio-temporal change in placental insulin receptor (IR) expression suggests a shift in regulation of placental insulin effects from mother to fetus. In the first trimester, IRs are predominantly expressed on the syncytiotrophoblast (ST) facing the maternal circulation, whereas at term the placental endothelial cells (EC) facing the fetal circulation are the main expression site. The x-axis represents the amount of IR expression by visual inspection and the y-axis displays the course of gestation. Photographs of immunohistochemical stainings for the IR in first trimester (left) vs. term placental tissue (right) within the diagram are taken from with kind permission of Springer Science and Business Media.

Location of insulin receptors (IR) in endothelium along the vascular tree in the human term placenta. Strong IR staining (thick red line) was restricted to arteries and veins of big stem villi and to capillaries at the site of branching of terminal villi from mature intermediate villi. Moderate IR staining (dotted red line) was found in arteries and veins of smaller stem villi. The sinusoids in terminal villi were also focally labelled. All other capillaries, arterioles and venules as well as the umbilical cord vessels were weakly stained if at all. Modified according to data in , ) from published in ) with kind permission of Springer Science and Business Media.

Relative IGF1R mRNA abundance in first trimester (F) and term (T) placental tissue, isolated first trimester (FT) and term trophoblasts (TT), and term arterial (ECA) and venous (ECV) endothelial cells. Expression of mRNA was measured by semi-quantitative RT-PCR (mean ± SEM; n = 5). Total RNA was isolated using TriReagent (Molecular Research Center Inc., Cincinnati, OH, USA). Primers were designed so as to include splicing sites within the amplicon. The ribosomal protein L30 (RPL30) was used as an internal control because of its stable expression within the investigated placental cell types and tissues. Sequences of forward (for) and reverse (rev) primers: RPL30 for: CCTAAGGCAGGAAGATGGTG; RPL30 rev: CAGTCTGTTCTGGCATGCTT; IGF1R for: GGATGCGGTGTCCAATAACT; IGF1R rev: TGGCAGCACTCATTGTTCTC. For RPL30, 25 cycles and for IGF1R, 29 cycles were used for the amplification of 100 ng RNA at an annealing temperature of 60 °C. PCR-products were electrophoresed on 2.5% agarose gels, documented with the Eagle-Eye™ system (Stratagene, CA, USA) and quantified using AlphaDigiDoc 1000 (Alpha Innotech, CA, USA) software. The optimal RT-PCR cycle number for RPL30 and IGF1R was determined to lie within the linear range of the amplification in preliminary experiments (not shown). Mann–Whitney rank sum test (SigmaPlot10; Jandel Scientific, San Rafael, CA, USA) was used for statistical data analysis. P < 0.05 was considered statistically significant.

Immunohistochemical localization of IGF1R in the human placenta of the first trimester (a) and at term of gestation (b–d). (a) In the first trimester (week 10 post menstruation) the plasma membrane of the villous cytotrophoblast (CT) was strongly stained as was the basal membrane of the syncytiotrophoblast (ST); other cells in the stroma did not immunoreact. Among the extravillous cytotrophoblast (evCT) only three to five proximal cellular layers of the cell columns, representing the proliferative phenotype, were strongly labelled, whereas the more distal invasive evCTs were unlabelled. (b–d) Cross-sections of a mature intermediate villus (b) and stem villus (c,d). The basal plasma membrane of the ST and the villous CT are strongly and continuously stained. The microvillous ST membrane is weakly and discontinuously stained (arrowheads). Tissue macrophages (M) are also strongly labelled. Endothelial cells in capillaries (Cp in c) are weakly and discontinuously labelled, whereas in larger calibre vessels they are moderately and continuously stained (d). (e) Negative control by omission of primary antibody. Magnification bars represent 20 µm. To allow easier identification of key structures the surrounding villi were erased in (a–c) using photoshop software. The immunohistochemical staining method essentially followed an established protocol (). Labelling was detected with the LSAB-kit detection system (Dako, Vienna, Austria). The monoclonal antibody against the IGF1R (clone αIR3; dilution 1 : 10; Oncogene Science Inc, Cambridge, MA, USA) immunoprecipitates the α- and β-subunits of human IGF1R. The antibody blocks IGF1 binding to its receptor without affecting insulin receptors ().

MT1-MMP expression in first trimester trophoblasts is stimulated by insulin, IGF1 and IGF2 by different signalling pathways. Insulin signals via the two isoforms of the insulin receptor, i.e. IR 11+ and IR 11−. IGF1 binds to the IGF1R, whereas IGF2 binds to IGF1R as well as to IR 11−. The pathways activated by the receptor tyrosine kinases ultimately inducing MT1-MMP transcription differ. Insulin receptor signalling is inhibited by Wortmannin, which blocks the PI3K/PKB pathway. In contrast, IGF1R signalling is abolished by U0126, an inhibitor of the MEK/ERK1/2 pathway. The IGF2-induced up-regulation of MT1-MMP is inhibited by both compounds ().