Allele specific expression analysis of the IL-2 gene. Three (NOD × NOD.B6 Idd3)F1 mice were stimulated in vivo with 5 μg anti-CD3 (clone 2C11) for one hour, and cDNA was made from DNase treated total RNA extracted from whole spleen. The PCR product generated using primers flanking a NOD/B6 SNP in intron 2 of IL-2 (forward primer: AAAGAATGGCCCAACTTTCA, reverse primer: TTTCATTGGGACAAATAGATTTTACA) was cloned into a topo vector (Invitrogen), and colony PCR performed on the transformed cells. Restriction digestion with RsaI (New England Biolabs), which cuts the cloned PCR product of the NOD allele but not that of the B6, was used to score each clone.