Format

Send to

Choose Destination
See comment in PubMed Commons below
Proc Natl Acad Sci U S A. 1991 Aug 15;88(16):7266-70.

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

Author information

1
Carlsberg Research Laboratory Copenhagen, Denmark.

Abstract

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

PMID:
1831269
PMCID:
PMC52275
[Indexed for MEDLINE]
Free PMC Article
PubMed Commons home

PubMed Commons

0 comments
How to join PubMed Commons

    Supplemental Content

    Full text links

    Icon for HighWire Icon for PubMed Central
    Loading ...
    Support Center