dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EGP_SNPS
Submitter Batch ID:DIA1-PDR90-071503
Submitter Method ID:METHOD-E
Citation:NIEHS-SNPs, Environmental Genome Project, NIEHS ES15478.
Batch Total SubSNP(ss) Count:181

all, sort by
SubSNP(ss) Submitter
Samplesize RefSNP(rs) ss2rs
Chr ChrPos Contig
ss12583982 DIA1-003165 A/T 174 rs8190387 0 22 42646676 NT_011520.13 23937112
ss12583981 DIA1-003129 A/G 176 rs8190386 0 22 42646712 NT_011520.13 23937148
ss12583980 DIA1-002760 C/T 144 rs2284090 1 22 42647081 NT_011520.13 23937517
ss12583979 DIA1-002677 A/C 142 rs5996204 1 22 42647164 NT_011520.13 23937600
ss12583978 DIA1-002672 C/G 142 rs2267458 1 22 42647169 NT_011520.13 23937605
ss12583977 DIA1-002609 A/C 142 rs8190385 0 22 42647232 NT_011520.13 23937668
ss12583976 DIA1-002332 G/T 160 rs8190384 0 22 42647509 NT_011520.13 23937945
ss12583975 DIA1-002239 -/CTATTTTTTGTACTTTTAGTAGAGACAGG 138 rs376525577 0 22 42647573 NT_011520.13 23938009
ss12583974 DIA1-002199 C/T 152 rs8190382 0 22 42647613 NT_011520.13 23938049
ss12583973 DIA1-002060 C/T 150 rs8190381 0 22 42647752 NT_011520.13 23938188
ss12583972 DIA1-001987 A/G 148 rs8190380 0 22 42647825 NT_011520.13 23938261
ss12583971 DIA1-001942 -/CTTTTTT 150 rs150223662 1 22 42647864 NT_011520.13 23938300
ss12583970 DIA1-001864 A/T 152 rs2267459 1 22 42647948 NT_011520.13 23938384
ss12583969 DIA1-001678 C/T 162 rs8190378 0 22 42648134 NT_011520.13 23938570
ss12583968 DIA1-001669 A/G 160 rs8190377 0 22 42648143 NT_011520.13 23938579
ss12583967 DIA1-001610 A/T 160 rs137142 1 22 42648202 NT_011520.13 23938638
ss12583965 DIA1-001529 -/CCTCTA 170 rs8190375 0 22 42648278 NT_011520.13 23938714
ss12583963 DIA1-001244 -/GTCC 172 rs199960666 1 22 42648564 NT_011520.13 23939000
ss12583962 DIA1-001088 G/T 170 rs8190372 0 22 42648720 NT_011520.13 23939156
ss12583961 DIA1-001049 C/T 172 rs8190371 0 22 42648759 NT_011520.13 23939195
ss12583960 DIA1-000519 C/T 178 rs8190370 0 22 42649289 NT_011520.13 23939725
ss12583959 DIA1-000427 A/G 178 rs8190369 0 22 42649381 NT_011520.13 23939817
ss12583958 DIA1-000356 A/C 178 rs8190368 0 22 42649452 NT_011520.13 23939888
ss12583957 DIA1-000301 -/A 166 rs8190367 0 22 42649507 NT_011520.13 23939943
ss12583956 DIA1-000276 A/G 162 rs8190366 0 22 42649531 NT_011520.13 23939967
ss12583955 DIA1-000248 A/G 160 rs8190365 0 22 42649559 NT_011520.13 23939995
ss12583954 DIA1-000220 A/G 142 rs8190364 0 22 42649587 NT_011520.13 23940023
ss12583953 DIA1-000192 -/C 98 rs8190363 0 22 42649615 NT_011520.13 23940051
ss12583964 DIA1-001246 C/T 172 N.D. N.D.
ss12583966 DIA1-001585 -/GGACCTGGAGTCTCCTCCTTGGGGA 160 rs869171020 0 N.D. N.D.
30 of 181 subsnp's starting at ss12583982. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement