NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EGP_SNPS
Submitter Batch ID:CCNE1-PDR90-060702
Submitter Method ID:METHOD-E
Citation:NIEHS-SNPs, Environmental Genome Project, NIEHS ES15478.
Population:PDR90
Comment:These SNPs were generated as part of the NIEHS supported grant (HL66682) for the Environmental Genome Project to develop SNP resources distributed to the research community. Please see egp.gs.washington.edu for details on how to cite this work. The first descriptor in the "Submitter SNP ID:" field indicates the HUGO assigned name of the gene studied. The second number denotes the variant base position in the listed GenBank accession number.
Batch Total SubSNP(ss) Count:60


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss4479087 CCNE1-000267 A/C 168 rs3218026 0 19 29812231 NT_011109.17 2571357
ss4479088 CCNE1-000481 C/T 178 rs3218027 0 19 29812445 NT_011109.17 2571571
ss4479089 CCNE1-000514 -/G 170 rs3218028 0 19 29812478 NT_011109.17 2571604
ss4479090 CCNE1-000844 -/C 154 rs3218029 0 19 29812808 NT_011109.17 2571934
ss4479091 CCNE1-001148 G/T 172 rs3218030 0 19 29813111 NT_011109.17 2572237
ss4479092 CCNE1-001514 A/G 160 rs3218031 0 19 29813477 NT_011109.17 2572603
ss4479093 CCNE1-001515 C/T 160 rs3218032 0 19 29813478 NT_011109.17 2572604
ss4479094 CCNE1-001613 C/T 174 rs997669 1 19 29813576 NT_011109.17 2572702
ss4479095 CCNE1-002271 A/G 176 rs3218033 0 19 29814234 NT_011109.17 2573360
ss4479096 CCNE1-002522 -/T 162 rs397840401 0 19 29814485 NT_011109.17 2573611
ss4479097 CCNE1-002579 C/T 122 rs3218035 0 19 29814542 NT_011109.17 2573668
ss4479098 CCNE1-002814 A/G 164 rs3218036 0 19 29814777 NT_011109.17 2573903
ss4479099 CCNE1-003008 A/G 158 rs3218037 0 19 29814971 NT_011109.17 2574097
ss4479100 CCNE1-003025 G/T 150 rs3218038 0 19 29814988 NT_011109.17 2574114
ss4479101 CCNE1-003536 A/G 176 rs3218039 0 19 29815499 NT_011109.17 2574625
ss4479102 CCNE1-003575 A/G 176 rs3218040 0 19 29815538 NT_011109.17 2574664
ss4479103 CCNE1-003822 C/T 166 rs3218041 0 19 29815785 NT_011109.17 2574911
ss4479104 CCNE1-004469 A/T 176 rs3218042 0 19 29816431 NT_011109.17 2575557
ss4479105 CCNE1-004487 A/G 176 rs3218043 0 19 29816449 NT_011109.17 2575575
ss4479106 CCNE1-004582 A/T 176 rs3218044 0 19 29816544 NT_011109.17 2575670
ss4479107 CCNE1-005516 C/T 174 rs3218045 0 19 29817478 NT_011109.17 2576604
ss4479108 CCNE1-005766 C/T 162 rs3218046 0 19 29817728 NT_011109.17 2576854
ss4479109 CCNE1-005775 A/G 162 rs3218047 0 19 29817737 NT_011109.17 2576863
ss4479110 CCNE1-006045 A/G 156 rs3218048 0 19 29818007 NT_011109.17 2577133
ss4479111 CCNE1-006850 G/T 156 rs3218049 0 19 29818812 NT_011109.17 2577938
ss4479112 CCNE1-007029 A/G 162 rs3218050 0 19 29818991 NT_011109.17 2578117
ss4479113 CCNE1-007433 A/G 178 rs3218051 0 19 29819395 NT_011109.17 2578521
ss4479114 CCNE1-007589 C/G 178 rs3218052 0 19 29819551 NT_011109.17 2578677
ss4479115 CCNE1-007624 G/T 178 rs3218053 0 19 29819586 NT_011109.17 2578712
ss4479086 CCNE1-000112 -/GCGCCGCCGCCGCCACTGCCGT 174 rs869123678 0 N.D. N.D.
30 of 60 subsnp's starting at ss4479087. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement