NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EGP_SNPS
Submitter Batch ID:MCM3-PDR90-051204
Submitter Method ID:METHOD-E
Citation:NIEHS-SNPs, Environmental Genome Project, NIEHS ES15478.
Population:PDR90
Comment:These SNPs were generated as part of the NIEHS supported grant (HL66682) for the Environmental Genome Project to develop SNP resources distributed to the research community. Please see egp.gs.washington.edu for details on how to cite this work. The first descriptor in the "Submitter SNP ID:" field indicates the HUGO assigned name of the gene studied. The second number denotes the variant base position in the listed GenBank accession number.
Batch Total SubSNP(ss) Count:162


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss23143579 MCM3-005448 C/T 174 rs12214090 1 6 52281298 NT_007592.16 52221298
ss23143578 MCM3-005438 A/G 172 rs17239880 0 6 52281308 NT_007592.16 52221308
ss23143577 MCM3-005272 G/T 144 rs6934554 1 6 52281474 NT_007592.16 52221474
ss23143576 MCM3-004424 -/AAA 148 rs17239866 0 6 52282320 NT_007592.16 52222320
ss23143575 MCM3-004273 A/G 150 rs7756989 1 6 52282473 NT_007592.16 52222473
ss23143574 MCM3-004235 G/T 152 rs7774976 1 6 52282511 NT_007592.16 52222511
ss23143573 MCM3-004181 C/T 150 rs12202495 1 6 52282565 NT_007592.16 52222565
ss23143572 MCM3-004142 C/G 158 rs17246240 0 6 52282604 NT_007592.16 52222604
ss23143571 MCM3-004115 A/G 146 rs17246233 0 6 52282631 NT_007592.16 52222631
ss23143570 MCM3-004068 C/T 160 rs17239852 0 6 52282678 NT_007592.16 52222678
ss23143569 MCM3-003925 A/C 168 rs2307318 0 6 52282821 NT_007592.16 52222821
ss23143568 MCM3-003852 A/T 168 rs2307322 0 6 52282894 NT_007592.16 52222894
ss23143567 MCM3-003770 A/G 172 rs17239832 0 6 52282976 NT_007592.16 52222976
ss23143566 MCM3-003696 -/ATTTTACTGAGTCTTATAGGATGGT 172 rs17246226 0 6 52283025 NT_007592.16 52223025
ss23143565 MCM3-003667 G/T 170 rs17246219 0 6 52283054 NT_007592.16 52223054
ss23143564 MCM3-003581 C/T 168 rs17246212 0 6 52283140 NT_007592.16 52223140
ss23143563 MCM3-003494 A/G 166 rs9474191 1 6 52283227 NT_007592.16 52223227
ss23143562 MCM3-003073 C/G 168 rs17239825 0 6 52283648 NT_007592.16 52223648
ss23143561 MCM3-003054 A/C 168 rs9474192 1 6 52283667 NT_007592.16 52223667
ss23143560 MCM3-002891 A/G 168 rs17239811 0 6 52283830 NT_007592.16 52223830
ss23143559 MCM3-002797 -/TGAAA 168 rs17239804 0 6 52283920 NT_007592.16 52223920
ss23143558 MCM3-002263 C/G 152 rs11962162 1 6 52284458 NT_007592.16 52224458
ss23143557 MCM3-002151 C/G 156 rs3087342 0 6 52284570 NT_007592.16 52224570
ss23143556 MCM3-001925 C/T 158 rs17246191 0 6 52284796 NT_007592.16 52224796
ss23143555 MCM3-001836 -/A 156 rs17246184 0 6 52284885 NT_007592.16 52224885
ss23143554 MCM3-001167 -/GTA 168 rs17246177 0 6 52285551 NT_007592.16 52225551
ss23143553 MCM3-001136 -/CT 170 rs67542076 0 6 52285581 NT_007592.16 52225581
ss23143552 MCM3-001090 C/T 172 rs17239783 0 6 52285628 NT_007592.16 52225628
ss23143551 MCM3-000673 C/G 176 rs12525044 1 6 52286045 NT_007592.16 52226045
ss23143550 MCM3-000411 G/T 176 rs17239769 0 6 52286307 NT_007592.16 52226307
30 of 162 subsnp's starting at ss23143579. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement