NCBI
dbSNP
dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Re-designed RefSNP Report page!
Clean, modern design that makes it easy to find the information that you are looking for. Report any problems by sending us an email.
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Reference SNP (refSNP) Cluster Report: rs8175347                 ** With drug-response allele **
RefSNP
Organism:human (Homo sapiens)
Molecule Type:Genomic
Created/Updated in build:117/151
Map to Genome Build:108/Weight 1
Validation Status:byClusterbyFreq
Citation:PubMedLitVarNEW
Allele
Variation Class:STR:
short tandem repeat (microsatellite) variation
RefSNP Alleles:(TA)5/6/7/8 (FWD)
Allele Origin:
Ancestral Allele:Not available
Variation Viewer:link to VariationViewer
Clinical Significance:With drug-response allele [ClinVar]
NA
HGVS Names
  • NC_000002.11:g.234668881_234668882TA[5][6][7][8]
  • NG_002601.2:g.175492_175493TA[5][6][7][8]
  • NG_033238.1:g.4963_4964TA[5][6][7][8]
  • NM_000463.2:c.-53_-52TA[5][6][7][8]
  • NM_001072.3:c.862-6799_862-6798TA[5][6][7][8]
  • NM_007120.2:c.868-6799_868-6798TA[5][6][7][8]
  • NM_019075.2:c.856-6799_856-6798TA[5][6][7][8]
  • NM_019076.4:c.856-6799_856-6798TA[5][6][7][8]
  • NM_019077.2:c.856-6799_856-6798TA[5][6][7][8]
  • NM_019078.1:c.868-6799_868-6798TA[5][6][7][8]
  • NM_019093.2:c.868-6799_868-6798TA[5][6][7][8]
  • NM_021027.2:c.856-6799_856-6798TA[5][6][7][8]
  • NM_205862.1:c.61-6799_61-6798TA[5][6][7][8]
  • XR_241238.1:n.924-6799_924-6798TA[5][6][7][8]
  • XR_241239.1:n.-31_-30TA[5][6][7][8]
  • XR_241240.1:n.1023-6799_1023-6798TA[5][6][7][8]
  • XR_241241.1:n.942-6799_942-6798TA[5][6][7][8]
Links
SNP Details are organized in the following sections:
GeneView Map Submission Fasta Resource Diversity Validation

  Integrated Maps (Hint: click on 'Chr Pos' to see variant in the new NCBI variation viewer) back to top

  GeneView back to top

GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A


  Submitter records for this RefSNP Cluster back to top
The submission ss69369242 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs8175347 during BLAST analysis for the current build.


NCBI
Assay ID
Handle|Submitter IDValidation
Status
ss to rs
Orientation
/Strand
Alleles5' Near Seq 30 bp3' Near Seq 30 bpEntry
Date
Update
Date
Build
Added
Molecule
Type
Freq
Warning
Ancestral
Allele
Success
Rate
ss69367662PHARMGKB_PAAR-UCHI|PS205084_PA142177573_-53RbyFreqfwd/(TA)6/7/8ttaacttggtgtatcgattggtttttgccaagtaggagagggcgaacctctggcaggagc03/22/0703/31/08136Genomicunknown
ss69369242PHARMGKB_PAAR-UCHI|PS203581_PA130445532_174990Rfwd/(TA)5/6/7/8ttaacttggtgtatcgattggtttttgccaagtaggagagggcgaacctctggcaggagc03/22/0703/22/07127Genomicunknown
ss69369603PHARMGKB_PAAR-UCHI|PS203397_PA129672004_-53RbyFreqfwd/(TA)5/6/7/8ttaacttggtgtatcgattggtttttgccaagtaggagagggcgaacctctggcaggagc03/22/0703/31/08136Genomicunknown
ss69370964PHARMGKB_PAAR-SJCRH|PS115680_PA115679_-53RbyFreqfwd/(TA)5/6/7/8ttaacttggtgtatcgattggtttttgccaagtaggagagggcgaacctctggcaggagc03/22/0703/31/08136Genomicunknown
ss69370965PHARMGKB_PAAR-SJCRH|PS115680_PA454961_-53RbyFreqfwd/(TA)5/6/7/8ttaacttggtgtatcgattggtttttgccaagtaggagagggcgaacctctggcaggagc03/22/0703/31/08136Genomicunknown

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|rs8175347|allelePos=76|totalLen=151|taxid=9606|snpclass=4|alleles='(TA)5/6/7/8'|mol=Genomic|build=136
 TTTGTGGACT GACAGCTTTT TATAGTCACG TGACACAGTC AAACATTAAC TTGGTGTATC
 GATTGGTTTT TGCCA
 N
 AGTAGGAGAG GGCGAACCTC TGGCAGGAGC AAAGGCGCCA TGGCTGTGGA GTCCCAGGGC
 GGACGCCCAC TTGTC

  NCBI Resource Links back to top
Submitter-Referenced
dbSNP Blast Analysis

  Population Diversity (Alleles in RefSNP orientation) back to top

Sample AscertainmentGenotypesAlleles
ss#PopulationIndividual
Group
Chrom.
Sample Cnt.
SourceHWP(TA)5
(TA)6
(TA)7
(TA)8
ss69367662PA142177574 588AF 0.772108850.226190480.00170068
ss69369603PA129672005 170AF 0.005882350.664705870.311764720.01764706
ss69370964PA456070 492AF 0.016260160.642276410.335365860.00609756
ss69370965PA456075 106AF 0.018867920.603773590.367924540.00943396

SummaryAverage
Het.+/- std err:
Individual
Count
Founders
Count
Individual
Overlap
Genotype
Conflict
0.429+/-0.1970000

  Validation Summary: back to top
Validation statusMarker displays
Mendelian segregation
PCR results confirmed
in multiple reactions
Homozygotes detected
in individual genotype data
byClusterbyFreqUNKNOWNUNKNOWNUNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement