dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Re-designed RefSNP Report page!
Clean, modern design that makes it easy to find the information that you are looking for. Report any problems by sending us an email.
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Reference SNP (refSNP) Cluster Report: rs4340                 ** With Pathogenic allele **
Organism:human (Homo sapiens)
Molecule Type:Genomic
Created/Updated in build:36/151
Map to Genome Build:108/Weight 1
Validation Status:byClusterbyFreq
Variation Class:NAMED:
insertion/deletion variation or named repetitive element
RefSNP Alleles:(288BP INDEL)/(ALU)/- (FWD)
Allele Origin:
Ancestral Allele:Not available
Variation Viewer:link to VariationViewer
Clinical Significance:With Pathogenic allele [ClinVar]
HGVS Names
  • NC_000017.10:g.61565892_61565893insA˙T
  • NC_000017.10:g.61565892_61565893ins˙˙˙B˙˙˙ND˙˙
  • NG_011648.1:g.16459_16460insA˙T
  • NG_011648.1:g.16459_16460ins˙˙˙B˙˙˙ND˙˙
  • NM_000789.3:c.2306-117_2306-116insA˙T
  • NM_000789.3:c.2306-117_2306-116ins˙˙˙B˙˙˙ND˙˙
  • NM_001178057.1:c.584-117_584-116insA˙T
  • NM_001178057.1:c.584-117_584-116ins˙˙˙B˙˙˙ND˙˙
  • NM_152830.2:c.584-117_584-116insA˙T
  • NM_152830.2:c.584-117_584-116ins˙˙˙B˙˙˙ND˙˙
SNP Details are organized in the following sections:
GeneView Map Submission Fasta Resource Diversity Validation

  Integrated Maps (Hint: click on 'Chr Pos' to see variant in the new NCBI variation viewer) back to top

  GeneView back to top

GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A

  Submitter records for this RefSNP Cluster back to top
The submission ss84149478 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs4340 during BLAST analysis for the current build.

Assay ID
Handle|Submitter IDValidation
ss to rs
Alleles5' Near Seq 30 bp3' Near Seq 30 bpEntry
ss84149478PHARMGKB_PARC|PS206642_PA151796275_13813byFreqfwd/(288BP INDEL)/-ttctcccatttctctagacctgctgcctatacagtcacttttatgtggtttcgccaattt12/06/0709/05/14130Genomicunknown

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|rs4340|allelePos=77|totalLen=152|taxid=9606|snpclass=5|alleles='(288BP INDEL)/(ALU)/-'|mol=Genomic|build=130

  NCBI Resource Links back to top
dbSNP Blast Analysis

  Population Diversity (Alleles in RefSNP orientation) back to top

Sample AscertainmentGenotypesAlleles
Sample Cnt.
SourceHWP(288BP INDEL)
ss84149478PA151796276 94AF 0.723404230.27659574

Het.+/- std err:

  Validation Summary: back to top
Validation statusMarker displays
Mendelian segregation
PCR results confirmed
in multiple reactions
Homozygotes detected
in individual genotype data

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement