NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Reference SNP (refSNP) Cluster Report: rs267234884                 
RefSNP
Organism:honey bee (Apis mellifera)
Molecule Type:Genomic
Created/Updated in build:137/149
Map to Genome Build:103/Weight
Validation Status:
Allele
Variation Class:NAMED:
insertion/deletion variation or named repetitive element
RefSNP Alleles:(K0225) (FWD)
Allele Origin:
Ancestral Allele:Not available
Links
SNP Details are organized in the following sections:
GeneView Map Submission Fasta Resource Diversity Validation

  Integrated Maps (Hint: click on 'Chr Pos' to see variant in the new NCBI variation viewer) back to top

  GeneView back to top

GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A


  Submitter records for this RefSNP Cluster back to top
The submission ss181953212 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs267234884 during BLAST analysis for the current build.


NCBI
Assay ID
Handle|Submitter IDValidation
Status
ss to rs
Orientation
/Strand
Alleles5' Near Seq 30 bp3' Near Seq 30 bpEntry
Date
Update
Date
Build
Added
Molecule
Type
Freq
Warning
Ancestral
Allele
Success
Rate
ss181953212UNISTS|K0225fwd/(K0225)aaaaaacaaacttttaattcatagcatcctaacagcgtttcaggattgcatgattttaat12/15/0912/15/09137Genomicunknown

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|rs267234884|allelePos=528|totalLen=1047|taxid=7460|snpclass=5|alleles='(K0225)'|mol=Genomic|build=137
 AATTATATCT TAATAATTTA TTTATTCTAT TAAATCAAAT TGTATCACAT TGATAAATTA
 AAATTTATAT AATTGTAATT AAAACTAATT TATTTTCTAA CAATTAAAAA AAATTGAACT
 GAAAATTTTT TGATTAAATA ATAAATTAAA AGATATTTGA AGATATATTT CCAATCATTT
 CAATGATGAT TGTTAATTTT ATTAATTTTA CAATTTAAGC TTTTTTTATT ATCAAATAAA
 ATAGAGTATT TATATAAACT AGTGTTAATT TATCTATTAA GATATTCTTT CTCACAGACT
 TACTATTCAA GGTTCATCAT GAACTACATT GTGCCCGTTT CATCTTAATA GTTACATTAG
 GTGTACCGTA ATGCTATTTC TTTTCATTAC CTGGCTCGCC TAGCAATCTC ATACGAAAAT
 CTATATAATT TTCCTTGTCG TAAACTCTTT CAGCGCGTTG ACTACGTAGA CGCACCACTC
 CTTCACCAAT CACATGAAAA
 AAACAAACTT TTAATTCATA GCATCCT
 N
 AACAGCGTTT CAGGATTGCA
 TGATTTTAAT ATAATATAAT ATAATATAAT ATATATAAAT AATTAATTAC ATTTCTAGAA
 AGTTTTTTAT AACTTAAAAA TTATTGTGTT AAATTAATAT TTTGAGGAAT ATTATTATTA
 ATTACTATTA ATTATTATAT TAGATAAAAA TTATGAACAG AAAACAAAAA TAAATTAAAT
 AACATATATG TTCATTCATA TGTTCATTAA TCTATATAAA TAATTTTGTG TAATTTATTT
 AATCATATTA TTAAAAACAT TTTATTTATA TTATGAAAAT TTACAATAAA GAAAAAAGTC
 ATAATTAATA TAAATTTAAA TATATTTAAT TATTTAAATT GCACATTTTT ATACGATCTC
 TAATATTTTA AAAGTAGAAT TATTTATTCA CTATAATTTC ATAATCACTA TATATATCAT
 TAAATATATA AATATAATAA AATATTTGTT TTATTTATAG TGAATATTTC ACAAATAATT
 TCATTTTATC AATTCAATT

  NCBI Resource Links back to top
Submitter-Referenced
dbSNP Blast Analysis

  Population Diversity (Alleles in RefSNP orientation) back to top
There is no frequency data.

  Validation Summary: back to top
Validation statusMarker displays
Mendelian segregation
PCR results confirmed
in multiple reactions
Homozygotes detected
in individual genotype data
UNKNOWNUNKNOWNUNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement