NCBI CCDS banner
PubMed Entrez Gene BLAST OMIM
  

CCDS
Home
FTP
Process
Releases & Statistics
Curation Guidelines

Collaborators
EBI
HGNC
MGI
NCBI
WTSI

Contact Us
email CCDS

Genome Displays

Ensembl
NCBI
UCSC
VEGA

Related Resources
Gene
HomoloGene
RefSeq
UniGene

Report for CCDS48483.1 (current version)

CCDS Status Species Chrom. Gene CCDS Release NCBI Annotation Release Ensembl Annotation Release Links
48483.1 Public Mus musculus 1 Spata45 21 106 86 CCDS HistoryNCBI Gene:75558Re-query CCDS DB by CCDS ID:48483.1Re-query CCDS DB by GeneID:75558See the combined annotation on chromosome 1 in Sequence Viewer

Public since: CCDS release 7, NCBI annotation release 37.2, Ensembl annotation release 61

Review status: Reviewed (by RefSeq and Havana)

Sequence IDs included in CCDS 48483.1

Original Current Source Nucleotide ID Protein ID Status in CCDS Seq. Status Links
Original member Current member EBI,WTSI ENSMUST00000077889 ENSMUSP00000077049 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000077889Link to Ensembl Protein Viewer:ENSMUSP00000077049Re-query CCDS DB by Nucleotide ID:ENSMUST00000077889Re-query CCDS DB by Protein ID:ENSMUSP00000077049
Original member Current member EBI,WTSI ENSMUST00000192151 ENSMUSP00000141721 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000192151Link to Ensembl Protein Viewer:ENSMUSP00000141721Re-query CCDS DB by Nucleotide ID:ENSMUST00000192151Re-query CCDS DB by Protein ID:ENSMUSP00000141721
Original member Current member EBI,WTSI OTTMUST00000129936 OTTMUSP00000069730 Accepted alive Link to Vega Transcript Viewer:OTTMUST00000129936Link to Vega Protein Viewer:OTTMUSP00000069730Re-query CCDS DB by Nucleotide ID:OTTMUST00000129936Re-query CCDS DB by Protein ID:OTTMUSP00000069730
Original member Current member EBI,WTSI OTTMUST00000129937 OTTMUSP00000069731 Accepted alive Link to Vega Transcript Viewer:OTTMUST00000129937Link to Vega Protein Viewer:OTTMUSP00000069731Re-query CCDS DB by Nucleotide ID:OTTMUST00000129937Re-query CCDS DB by Protein ID:OTTMUSP00000069731
Original member Current member NCBI NM_029336.1 NP_083612.1 Accepted alive Link to Nucleotide Sequence:NM_029336.1Link to Protein Sequence:NP_083612.1Re-query CCDS DB by Nucleotide ID:NM_029336Re-query CCDS DB by Protein ID:NP_083612Link to BLAST:NP_083612.1

RefSeq Length Related UniProtKB/SwissProt Length Identity Gaps Mismatches
NP_083612.1 97 Q9CVW4 97 100% 0 0

Chromosomal Locations for CCDS 48483.1

Assembly GRCm38.p4 (GCF_000001635.24)

On '+' strand of Chromosome 1 (NC_000067.6)
Genome Browser links: Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 1Link to Ensembl Genome Browser on chromosome 1Link to Vega Genome Browser on chromosome 1See the combined annotation on chromosome 1 in Sequence Viewer

Chromosome Start Stop Links
1 191039583 191039856 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 1Link to Ensembl Genome Browser on chromosome 1Link to Vega Genome Browser on chromosome 1
1 191042879 191042898 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 1Link to Ensembl Genome Browser on chromosome 1Link to Vega Genome Browser on chromosome 1

CCDS Sequence Data
Blue highlighting indicates alternating exons.
Red highlighting indicates amino acids encoded across a splice junction.
 
Mouse over the nucleotide or protein sequence below and click on the highlighted codon or residue to select the pair.

Nucleotide Sequence (294 nt):
ATGACATCCATGAACAAGGGCAACGAAGAGAAGACACAGGGAGCGAACAGGAAGCAGCTTCTGGAAGAGT
TG
AACGAGAAGCGCGAGTCCTACTGCCTGGTGGAAAGAAGCAACGAAGTCAACCTGCTGAGAGTTCAGAA
G
AGGCACTTCAGCAAGGCCTACCAGACCTTAGCTTGCATGCATATCAAAGAATCTGTTCCCGAAAGTACC
AGG
ACCTCCTGGGTCAAGCATGATCTCTCTGTGCACAAGGAGAAAAGGCACTTTCTGCCAAAAAATAATG
CC
ATATTTGGATGA


Translation (97 aa):
MTSMNKGNEEKTQGANRKQLLEELNEKRESYCLVERSNEVNLLRVQKRHFSKAYQTLACMHIKESVPEST
R
TSWVKHDLSVHKEKRHFLPK
NNAIFG



Links Key
 Links to:   History report
  BLAST report
  Entrez Gene
  Nucleotide report
  Protein report
 Re-query CCDS DB by:   CCDS ID
  Gene ID
  Nucleotide ID
  Protein ID
 Genome Browser Links:   Ensembl Genome Browser
  NCBI Sequence Viewer
  UCSC Genome Browser
  VEGA Genome Browser