Display Settings:

Format

Send to:

Choose Destination
Pr012849275

STS probe AL023925 for DXZ4 associated non-coding transcript 2, distal (DANT2)

Synopsis

Field NameValues
NameAL023925
AliasesDJ474E24T7; stSG38531
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneDANT2
UniSTS IDUniSTS:9958

Sequences

>Probe|12849275|PRIMERF Forward PCR primer (outermost) (20b)
ACTAGCCTGCCTTCCTGACA
>Probe|12849275|PRIMERR Reverse PCR primer (outermost) (20b)
CCAGTCTCCTTCTCGTCCTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL023925

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID9958
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center