Display Settings:

Format

Send to:

Choose Destination
Pr012848562

STS probe DXS1519 for highly divergent homeobox (HDX) and 1 more gene

Synopsis

Field NameValues
NameDXS1519
AliassWXD962
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHDX; HDX
UniSTS IDUniSTS:98879

Sequences

>Probe|12848562|PRIMERF Forward PCR primer (outermost) (24b)
AACAATCTATCCACATACTAATCC
>Probe|12848562|PRIMERR Reverse PCR primer (outermost) (24b)
TGAAATCCATTTCCTCTAAATCAG

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS1519
Homo sapiensphysicalWUSTL-XX2.4 ordinalsWXD962

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID98879
Probe Cross-refcontext specific help for: Probe Cross-refGDB:262043
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center