Display Settings:

Format

Send to:

Choose Destination
Pr012847513

STS probe DXS7616 for protocadherin 11 X-linked (PCDH11X) and 2 more genes

Synopsis

Field NameValues
NameDXS7616
AliasesDXYS246; HUMSWX1265; sWXD1265
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100508338; PCDH11X; PCDH11Y
UniSTS IDUniSTS:9793

Sequences

>Probe|12847513|PRIMERF Forward PCR primer (outermost) (19b)
ACGTCACTGACAAACTGAG
>Probe|12847513|PRIMERR Reverse PCR primer (outermost) (23b)
GATAGGTAATACACACACCAAAC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7616
Homo sapiensphysicalWUSTL-XX2.9 ordinalsWXD1265

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID9793
Probe Cross-refcontext specific help for: Probe Cross-refGDB:600121
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center