Display Settings:

Format

Send to:

Choose Destination
Pr012847446

STS probe D19S1121 for GATA zinc finger domain containing 2A (GATAD2A) and 1 more gene

Synopsis

Field NameValues
NameD19S1121
AliasesRH8080; SHGC-14810
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGATAD2A; GATAD2A
UniSTS IDUniSTS:9787

Sequences

>Probe|12847446|PRIMERF Forward PCR primer (outermost) (20b)
ACGTATAGCCACCCATTCCA
>Probe|12847446|PRIMERR Reverse PCR primer (outermost) (18b)
ATTGGGGAGGCTCTTTGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G319714 cr10000SHGC-14810
Homo sapiensradiation hybridGeneMap99-G319714 cr10000SHGC-14810
Homo sapienslinkageRutgers Map19 cmD19S1121
Homo sapiensradiation hybridNCBI RH19176.8 crSHGC-14810

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID9787
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737292; GDB:738408
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center